Description :
Non Conding Region
Location :
Scaffold_1:59684- 59723
Sequence
39 bases(100 bases per row)
AGTCCCGTTGGCACCAGGATACGTAGTAGATGGATGTTG