Description :
Non Conding Region
Location :
Scaffold_1:59359- 59498
Sequence
139 bases(100 bases per row)
TCGGAGGACGTGAAGGATTGGCCAGTGGACTCAGCCAACGGAATAAAAAGTCTGAAAGATAGGTTTATGTTTTCAACCAATCAGATATCTTTCACAAGAT
GCTGACGTACGTCAGGCTCACTTAGCGATTTGGCGACTA