Description :
Non Conding Region
Location :
Scaffold_1:59315- 60545
Sequence
1230 bases(100 bases per row)
GAGCTTGGCCACTCGTCTAACGTTTCTCAAGGAGCAAGGACGTGCAACGTCCACCTCGAGAGTCTCTCTCCAGCGGAGACTCTCGATCTAGGGTTAGGGT
GGTGAGGATGAAGCTTAAAACAAGGAAACCCAAGACTAAGCTAAGCTTGGTCAGGCCCAGCTCGGATTCGGTCTGTCGGGTTGTTTAGTTGggcgctaca
tgtagttttCGTGTCGACACCACATGCTGTACAATGCATTATACAGACCTTGAGAGTTTCTGGATCGTTTCATGCACGGATCGAATAAGCGACCATCTCT
TTACGTCCAGGCACGTTCGTCCTCAATCGCAGACAAGAACCTCGCCAACCGCTCCGCGAAGGAGaaatcccccccccccatgCTTGTGTGACTAGTAGTC
ACTGGCAATTACTTTGTAACGTGTCTGAGGTACCCTGTACGCCGAGTCGTCGTATGCCCAGTGTCCACACGCCGTTCACCTCGAACTTCACTCGTCTGCT
GGTTCCCGGAGAGAACTGATATCCCCTGCGCCGGTACTTGCCTCGCTGGACAAGCTACCTATTTGTATTCCGTTCCTTAACGAAGTCCCCAGTACTAACA
TTAACTACAGAGAGCctttcagcgacgccgctgaGTCACTCGGAACACACAGGCCCCTTACGTCGCAACCCAGAGACTCGGAAACACACTGGCCTCCTGC
CCTCCGGTCCTGTGCACAGCCTCGCACTGTTCGTCCGTCCGCtagcacgtcgcccttggctCCGTCTGCTATTCTGTCTCGTTCGTTCGTTCGTCACTCG
CTTGGTCGGCTTGCcccagctcctggtgctgcCTTCCGTGTCTGACTCACTGCGTCCTGCTTCGCACTCCTTGACCGGCCACTTGCTCCTCGCGGCGCCA
ATCTCAAAGTGAACCAGTCCTCGCTGCcactcgtcgccgtcctgcgATCTTCGCGACCGACCCTTCGCTGGatacgacgaggagctccctCCTGGCGTGC
TTCTCGCTCTGTCCCACTCTGCGCAACTGCTTGCCGTCCATCAACTGATACTGCTGCTACTTCACCGTCCACGCCCTTGCCTGTGGTCATCGCATCCGTA
GACCTCTTACAACTTCGTGCCAGTTCGCAATGCGCATTCTTCATTTTGCCAACTCCAATTTCCCACCGAAAACCCACCGACAGTCCACAAAGTGTCATAC
AAGAATCATCACTGCTGACTATCAAGGAAA