Description :
Non Conding Region
Location :
scaffold_1:5931- 6079
Sequence
148 bases(100 bases per row)
GGGGCATCTCTCAAGTGGAATAAGACTCACTGCAGACTTCGACGCGAAGTGTAGGGTAATACACGCATCAGTGCTCCTCACTCCCAGCCTTTGCGTATCC
GTGCTTTTGTTCTCATGGCGGTCCAAGCAGATCTCGGTATTCTACTGC