Description :
Non Conding Region
Location :
Scaffold_1:59296- 60406
Sequence
1110 bases(100 bases per row)
GTTGGAGAGTCTTGAACAACGCAACACCGTGAAGGCTCATGCTGGAAGACACTGACTCCAGCGTAAGGTGGAGTTGTAAGGTAGATCGAGGCCACTGTAG
TAATACGATCAACACTGCCTTCCCGCCGAACCGAAAGCCAATTTCGACACGGACGCTATTTCATTGGAATAAGCGGCACAATCGGGATCCTATCTCATCG
GCTAGCGTGTCCGACTAGTATTAGCTGCTTCATCTTCAGCCCTCGATACGTGTTCCTAGTGCGAAGCAAGCCCAGCCAAAAATGCGAACCTCACTGGAGG
CAGATCGAAGCGGATCGGAAACACATTTCCCCACTCCGCGCGCCACTCAATACCCAAAGTGCTGAAATCAACACCGATGTGCTTCTGGTAGTTTCCAAAG
CTTCTGTCAGTGCCTATCGCATACTTTCCCTTACCACACGAAGCGGATTATTTCCCAGACTTTTAGTATTCGGATCGGAATGCAGTAAGTGATTCACGTA
TCGAGCCGACGCTGCGCGCCACTGTTTAGTTCCCCGTCTTTCAACTCTTGGAAAATAGGATGATATACCCGGGTCCAAAGGTGGCAAACAACAGCTTCAG
AGGGAGTGAAGAAACCCCACCCGGAAGTCCTAAGTCACACAGCCATCGATGATTCTTCGCCGAAGAACAAGAACCGGAGCGATTCATCGTACGGCACCTC
CTTAGTCACCGTAGCTGACGAGACTACAAACCCAGCAGCCCAAAAAAGGAAGGTACCGGCCTATACAAATCGAAGACAAACTATGTGACTCCGATATAct
acaccattgcacggcgttattcataaagtcaacactgaaatttaaaacgtgagcgctcaaattcaaaaccctgtcagatatatcaccttacaaaatttat
atatttgcgtaaatcgattgcaaagctaagctccaacttgcatgtgttcgaagcgcacgctggtggtgaggcaacgagtgacagaacgctctgttgcaca
actccggtgtgatgacttcagcgaagagagggtctgctgcaagctccaggaagccggcgtggtgctccgcgattgttgttccttctggaacacgcaggat
agcagggcgc