Description :
Non Conding Region
Location :
Scaffold_1:5927- 6076
Sequence
149 bases(100 bases per row)
CCGTGAAACCGCACATCTTGTCGCTGCTAGAATGTTTGAATGGAATACATATATTCGTACGGAGCACCATACGCTGCTCGGTGTACGTATCTTCAAGTCT
CGATGCGATTAGATCGGTGGTGGTCGACACGGTCTCTAGCGATAGTACT