Description :
Non Conding Region
Location :
Scaffold_1:59255- 72759
Sequence
13504 bases(100 bases per row)
CTGAACAGGAAAGTTAAGGTCAGCGGTCGGCCAAAGACGACAAGTCCACCCGAACGTGGTAACCTAAACAAGCAAAGCCATCCGCCTCGAAAATCATTTC
ACTGGAGTACGAGAGCTCTGAAGAATCCGACATTTGCATGGCGCCTGAGCACCACAACACTGGGTCAGCGTCATTTGAAATTGTATGTGATGCTCCATAT
GAAGGCTTCACGTACAATGCTTGGTACGACTTAGTGATGAGCATTCCAATTGTAAGAGTGCAAACTATGGTAGTACCAACGGCGTGCAAGATCCAGAAAG
ACAATTACAGCAGACTACCCGTCCGTGGAAAATGCAACCTACTTAGCGCAGGACTGGAGAAGTTATCGAACGAAGCTGTTACGTAGTACAAAAAGGCGCT
GGAACGGGAGGCAAAGGAATTGGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTCCGATTCAATTAGCTCATCAAATACTGCTCGGTTTCTCAGCCGCCAGAGCAACACCGGTGTTACAGT
TCCCAAATGATCCACAGTGTCTGCATAACTCGTTCATGGTCATTTGTCCACCTAGCCGTACATTCTTGTGCTTTCGCCATGAAATCGTGTTGACATTTCG
GTGCTGTAAGTATTGCATTGGCTAAAAGAAGCTCTTCCCTCTCCTTTGGCGTCTTGATCGGCCCATCCATTGATCCAACCACCGTTTCCATGCCGCCTGA
GCTTTTCCACACTCCCAAACAATATGATCTATGGTTTCGTGACTGCAATTGCATTTCAGATCAGGACAATCTCTTCTTTCCGGCCAACCTGCATGGTATA
GGTTTAGTTTCCTCAAAGCTAACCGGTATAGCATCCATATCTAATAATCCGTCACCATCCCATCGTTTGCCCATACTTGCCGTGGATTTTGTAGCAAAGC
TGCCTTCCCCCATTTTGACTTTTTCTCGTTCTGATCAATTTGTTCCATCACCGGTTTTAGTGTGTGCCTCAGTTGTCGTTTAAAATGTCTGGAACGTTGT
TTCCGGATAAGAAAGCTGAGATTCCATGCTTTCGATTCCACTGAGAGACTTAAAGGGTAGTTTGATGTTCTCAAATTCGCCTTGAATGAAATACCGCTTC
GAAAACGCCATTCTTGTATTCGTTCAAAGTCTTCTGTCTCCTCATAATCGGGCTGAATACCTAGTATCTACCAGGAAAACCCATCCTGGGCTTTCTGCAA
TGTAATAACCTCCCGCCATTGTCCGTTCTTTTGTTGTTTTCATAACATCTCTTGTGGTGTGTTTCCAGTGAACCATTCCAACGTGGTATGCAGTTTGGGC
ATCGAGATTGCCATAATTGGGCTCTTGGGTTCTTCCCTTTGACACTCAACATCACGACTTTACACCATTTCGCCACTTGCCGTAGATATTTTTTCACTTC
CTTCCCTTCTTGCATTAGAATTGTGATAATAGCTCCAAATTCTCTAGTATTTGGGCTAGGTTTTTCCACTTCTACCCTTAATTCTTGTAGTTTTGCTGAT
TTTAATGCTCCGAAAGCTCTTAGACGAAGTGGTTTTCCTTTGCCATCAATAACACACGCGTTATCATGCCACGGTGACTCTAGAAGGAATTCTAACTGTT
CCTCCGATAAATGTCTGTCAGATACCTCCTCTGCCGAGAAACACATTCTCCTCTCATCCAGTTGATATACCGAGCTAAGTTCTGGTCCTGCTTTTATTCT
GGTCTGTATGTTGTCTCTTTCGTCCGGTGGAGGTGTCATTCCTTCGGATTGTGCTTCCCATAATTCTGCAATTCCTGCTGCTTGAGTAGTCGGGGTGCCT
TTTCCTTTACGTTCTCTTAATATTTCCTGCACTGTTTCCCGTGTTGTTAGCCTAAATCTGCACAAGGATCCCTCACAGCGTTCCCCTGGGTGTACCATTG
CATGCCACGCTGTCAAATACTCATCTTGTATCTCTTGTACCCACGTATCCGCCAAATTACTTCTGGTTGCCTGTAACGCTAGGTTAATATCCTGTAGTCC
CAAGCCTCCATCATTCCTTGGTGTGAATACCAGCGCTGGATTTAGTTTGTGTTTCGTTCCTTCCGTCGATGTATTCGCATTCCATACAAATTGTTTCTGT
ATGTTCTCCAGCTTTCGCTGTATATCTTTTGGTACTACGAACTGTTTTCCTGTGTAGAGTATACTCGGAAGTGCCACTACATTGAACAGTATTACCCTCT
GAGCTACCGAATTGCTCGTTTGGGTAGCCACCCGTAGTCTTTTTTGTATTCTTTCGATGCGTATGTTCCAGTTTGCCCTCATTGTATCTTCATTCCCAAC
CCAGTACCCTAATTGTCAGGTATTTGCCTTCGGATCTAAGGCAGGAAAGCCACCCCACCTTGTTGGTGTACCCCTGGTGTTCAGTCCAGTTAGTAAGCTC
TTTTGGTCTTGGACCTGCAGGCCTGATAGTTCTCCAAATTTCCTCAAAATGTGTTTTACCACCTCTATATCTTCCATTGAGTTCATGAAAATGGTGCTAT
CATCCACAAAGGCTGAAAATTTGTGCCGTGCTTCTCCTGTTGTCGATATTCGTATCACTTTAATGTTCGGGTTGCTGTTAACCGCTCTACCTAGAGAATC
TGCAGCCAGTATGAACAATAGAGGTGCAAGCGGGCACCCTTGTCTTATCCCGGAGTTTACCCCCCCCCCCCCCTCATTGTTTAGATAATTGACCATTAAC
AAAAACTGTGCTGTTGTCCCTTCATGTAGCTGCCAAATGACATTAAGAAATTTTTCCGAGAAACCATATTTTCTGAGAACCTTTACCATATACGTCCGAT
CCAAAGTATCATAGGCTTTTCGTAAATCCAAGCATAGTGTTCCTGCACTCTGTGCCGACCCAAGATCTTCATTCTCGGCACTGTTCTTCAAGATAGCTCG
CAGCATCGTCACTGTTTTGTCAATTCTACGGCCCCGAACAAACCCTTGTTGACTGTTGCTAATGAGTTTGGGTAAGAATTGATGCAACCGCTCTGCCAGT
ATCCTTCCAAAGATTTTATACGCAGTGTTTAACAACGCAATGGGTCTGTAATCCATTGCATTATCAGAATCCCCATTTTTCCGAAGGGGGAGCACCGTCA
CCCTTAGAAATGAGTTTGGTACTCCATCTCCATTGATAATGGCATTATATAATTTGACCAGTCCAGGTGCCAATTGGGTAGCGAAGTCTTTATAAAAGGC
ATGGTTTAAGCCCGTAGTTCCTGCCGGCTTGTGCCTTTTGAGCTGCTGGATCGCCTCCCATACCTCCCATTCCGTTACCTCCATTACTAGTGAATCCGCA
TTAGCCTTCGTCAATTGTTGTTCCGTTGGGATATCCATGAATTTCTCCAATTGCTCATCTAGTGACTGACCTGCTACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTCTGCTGAGAGACAGTTTTGGTATACATGCGCCTTGCATGTCATGAGCGTTATAGAAGGTCACGCATTGT
AGGCCCGACGTCAGCAGCGTCGAGCATATCATAGTAAGTTCGCCAGCGCGGGTGAACGGTATCAATGGGAATCACGGGATTTCATTCATCTATATTATCA
GAAGCATAGCAGTTAGCCCACAGGTCCAAGCAGCAAACCAAACTGCAGTACCATTTGGCGGAAATAAATCACGTGCCGACAAGGAAGCAGCATGGTCCTA
GAAAATGAACAAGTGCAATCCCAGTTCTCCGTGTCCACTGTGTACTCGAGATTTCCTCTCCCACTGCTGCTCACGCGATATACGTTACTTCGTGTCTGTT
TGTACGCCATTATCGTCGATATCTGAAGTCACATACCAGTACGGAATTACATACGATCACACACTGCCACAAACTCTCACATGCGTCACTTACTTTAGTT
GCATACGCGTATCCAGGAAAAACTAGCCCTGCTGCGTGGTCAGTAGTCTTGTTTAGCAACTGGTTCATCTCCTCATCGTACTCAACGTGCCTAGTCACAC
CGATCCGCTGCATACCATGCACAAACACAAGTAAGCCCAGCTACTACTATTTAACCAGGCACAAACTAACATTAGTTTTTCGTGTGAATTCGCGCTCCTT
TAGCAACTGAAGCGCTATGATTGTCTCCATGCACTCATCTAGCGGTGTATCAGCATTCAGCTCAGGCTTGAGCTTGCTCCACCCTGACTCGATGCGGTTC
TTTGTGTTGTTCCCCAAGTGGGGGATATCCAGACGTAAATACTCGACCCAACGCTCCCGACAACCATCCCAATTATCGTTAAAATATTTCACGAATGGAT
GAATATCTTCCACGCCACCTTCCTCAGCGTCCTCGACATCTGACAGTACTTCCTTCTTCTTCTTCTCACGCCAAAACCGGTTCAGCTCACCAAATAGATC
ATCACGAGCTTCCAAATAAACAAACTCCGTTTTTGCGAATACCATTTGCTTGACAGACAAAAGCATACGAGTTTGAAGTTCATTGCTAAAATCACAACGA
GCTGCGTATAATGTACCACGATGGCAGTTAGTACTTACTTGTCTCTGAAATCCATCTTGCGAACGTACTTTTGATCTGCTTGAACCACTTCAACACATGA
AAACGACAGAGAAGAACTCGTGCATTAGGAAACATATCTTCCAACACACCAATTTCTGTCATGTCCTAACCAACCTGTACAACAAAAACAAAATAGTAAC
GTAAATTACCACATCAACGTTGGCGTTAGCTTGTGGCGCACCATAATTACTTCAACTTGACTCCAATCAGAGTTATTGGCTTGAAAGGCTTCAATAGCAT
TTTCCATGTTTTCACTGGTTTCTTGGTCGACAAACACATGCTGGACAAATTGCCCCTTTCCATAGGCATCCATGACCATGAAGGAAAACAGCTTGTACCG
GAGATCGTTTGTCTTGTGTGTCACATCAATTAGTAAAATCTCTGGAAATAAAGCAAAAATCTTTCTCATGCCGACAGTTTGAAATGTTAAGCATGTTGCA
ACGTTGCCATCATTCACGCAGCGTTGAGCTACGCTTCCAGGGTCCACCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCCGCATAATAATCACCGTCTGGCAGTTCTCTACATTCTTCTTGTAC
TGACACTTACTGAGCCGTTACCCGCTGGATTCTTCCAGGCCCCAGATTTTCTAAGGTTGATTGTGCGAATTTAGTCTCCAGAATCGCCCAACAACCAACA
GTATCAGCTCCATTCATCGCTGCATGTAAGTCCGGATTGACCTTTAGGATTTCAAACGGCACGTTAAGATGATCCATAATACTCTCCATCGTAGCTCCTT
GATTCCCTGCCAAAGTCTGTAGTTCAGCTTGGTACACGTAAGCCGATACTATAAGTCTCGACATCTTTTGACGGTCCGCTTCTCTACAAAGTTTAAGAAG
CTCAGAATTTGCATACTTCTTCTTTTTAATTGGTCCCCAAAATGCTCTGTTGTAGATGTTGTACCGATCCATACTGATTCGGTCTGGATCTGTGAGCTCC
ATCCTCCATTCCGCAAGCCAATTTTTAAGCTTTTCTGAAGATGTTTTTTTGAATGATATTAGTGATACTTGCAACTAAACACTCTCGCCTTGACTTTAAA
GTCCATTCATCCAGGATAGCCTCCGTCATCGTGCTAAGGATGTAATCAGGTGACTGAAAATGCTGAAGCAACCGCAACAATTCTTGAGGGGCCTACCAAT
TTCTATTTAGCAATGGACATGGGCATTGTTGGAAATTCTGCTGTCGTAGCACCTTGCCAAGATTCCTTCAAGTCGTTCCATTCGATCTTTAACACATGTT
CTGTCAATCGGTTCATCCCCAAGTTGCCTGTCATTCCAATAAATCTGCCAGTTCTTCTTCCCTCTTGCTCATTATCCAAGCGACCTTCCTGAATATCCAT
TTCTCTTGACGGAGGGGACCATTCTGATCCTTGGTCTGAAACCTCACTCGATTGCGAATTAGTCCATGTCGCTGTCAGTCCTCTGAGTCTGAAGTGATTC
TGCCATTCCTGTATATTCTCCCTTGTAACATCAAACTCTTTTGCCCACCGATCCAATGTCGCTGTATCAGTTAAATTCTCTTCTCGCAAAGCTGACCGTT
TCCCTGGTGCCATCCTTTCCAATCCGTCCGTTGGAAATGCTGATAGTTCATGTAGTCGATTACCCCCAGATTCCTCATTTTCTTCTCGTTCTATTTTGTC
GACCATCGTTTGAGTCGTTGTGCTGTTACCCGTTATTTCATCGGTCTCATTTTCCACTTCTTCCATTGCTATATCAGCCTCTAGTGCTGATGAAAATGTT
AATGATGGGTTGGTGGTTTCCTGCTTTCTCGCCGTCGCGCCAGTAGCTTCTCCTCTGAGTTTTCCTTGATGTTCTGAAATTTCATCCAGCTGTAGTGGTT
GCCATTGTATGCTAGTACAATTGGGTTGACCGAGTTCTCATTTCCTGCCATAACCTCCTGCTGTAGAGCCTGCACCCACCTTTGTAGCTTTCCTTTTGGC
ATATTTCGCTCTTTGGCCGACAAAAACCTCTTCCCTGGCACTCTTACCTCCGCAGGTTCAAACACTTGGTAGCTAGCATTCTCCATCCCCGTGCTTGCCA
GAATAACGAAAAAAAATTCTTTTCAGAAGCTTGGATAGCATTCTCAGTGTCTCCGCCGTTTCCCAAAACCGTGTCGGCAACTGTACATCCAGCTTCACTG
TCGATTTACAGAGAGACACCAGGTGCTATTTGTATTGGCGTGATGATTCCATAGCGTTAAACGTTGGAAGATTGGTAGCAGTCGCTTCCTGCTCCCGAAT
GGCTAAAGCTTTAAGAATAGATGAACGTTGATCATGAGGAAACTCTTGATCGAAGAAGTGATTAGATGCTGCGGTTATCCCCTTTTTTAGTTTCCGTGTC
AAGATCTCCAATGTCTCCACATTTTCCTTAGTGTCAAAGGTCTTGTTTAACAAAGCCATTGCCAGTTACCCGCCATAGGAGTACTCATCTCTTGCAGTCC
ACAGTCCCGCGTCACCTCATTACCGGTACGGTGCTCTTTTTGGTATTGACTCAATTTGAGTTTGCTGCATTTCTCGAAAGCGCTTTGATCGACTTCGGTA
TATCTTTCAGACACCAATTTCTCAATTAGGCCCCTGTGTTTCGTCATCGCCTGTGAACTCTGCCTCATTGCTTCTTTAATTGCTTCCGAAATGGTACTCC
CGTGCCATTCCTCCCCTCTCCCTTTATCTCTTTTGCCCCCTGTTCCAGATTCTAGCTTCTCTTCAGTATCCGGCTCCACCTCCACTGCCTTATGTTCTCC
TGAGCTCCTGCTAGTGTCCTGCTCCACCTCCGCTGCCTTATGTTCTCTAGAGCTCCTGTTGGGTTTCGACTGCGCTTTTAGTCCTGCTTTGAGTTCCTCC
TGTCTGCTGAACGTGTCTTTCTGGGTCTGTGACGTCGCTACCCTGCTGCTTTCCACTTCTTCCGGAGTGGTACTCAGTTTTCCAACCGTTCTCCACTCAG
CGTTACTTTGGCCGCTTTTTGCTGTACCATTTCTCTATGCAGGATTCGTACTATTGGACTTACTTGTTCGGAAGTATCCTTCAGCTGCGTTTCCTGAGAC
TCGCCTGGCTGGGTCTGTGTTGTCCTTCCCGTCGATTCGGCTTGTTGTTGCGTTCCCACCCACAGCATGTCTAGTGCTTCCACGCTAATTACTGTTGATT
GTTGCTTTGGAAGACTCTCAATTTCTTTCGCTGTCACTGTTAGATTGTAATGCCGTCTCCAAAATTCGTCCGTCGCCGTACACCCCGTCCTCATGTGGCC
CACCGCTCCGCACGAAAAACAAGGAGAGGCTGGTGATTTACTGACATGCTGAACCAGGATCTTCGTTCCATCCCAGTTAATGAACCGAATCACTTCCAGA
AACTGGGAACAGTGACTACTTTTGAAGAATATATCCCACGTGTCTGAGGAATCTGACCTGTTATTGTTGGTTCCTGCCAAGTTTGGTAGGTCCCCTGGAA
CCGCTTCTGGATGTACGCATCAGTTGCCGCTTCATCTAAGAACCTAGACAGGTTTATCAGGCGGACATGGTATCTGTCCCTTGGAAGCTCATTGCGAAGA
CCGTCCGCTCCCACTTGACGATTCCAAACAGCCATTGATCTCGATTCTGTTTTCGTCTGAACCGGTTGCTCTATCTCATGAGCATTGACCAGTGGGAATC
TTCTGTTTCGAAATGTCAGCGATCGGAACTGTTGGCTACATTTAGCTGCCATCTCCCGTGTCCAAAAGATGAGGTGAATCGCATGTTGTCCTTGGTCATA
GCAGATCTGCTTCGCCTCTTGCAGCATTGCTGTGACTTTTGCTGGGTCGTTTTCACTGTTATTGATACCTAACAGGAATTCGTGAGTCAGTCGTTTTCTG
GTTTGGAATTGCGGGTAAATCTTGAACTCTGCATTCAACTTTAACAAGAGATACCCTCCCACCTGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCATGGGCAAAGATCACCTACCGATTAAAACGGCCGCCTGCGCAAACAACTATTTCTGATATTCTCAATATGGCCCCCCAGATCATGAGCGACGACT
ACGGCGACGGCAAGTGGTGTAAGCCCCTCCGAGTGACGTCGCCCCAGCTGGAGAAGGAGCTGTGGGAGTGGATTCAGAAGGTAGAGGCGCAAGGCGTATG
CCTCTCACGTGAGCTCATCAAAATGAACGCTCGGGATATTCAACAGACACTCTGTGACGCGTGTGAGCTTACCTTTTCGGAAGGCTGGCTGAGTGCTTTT
GAGCGTAGACATCGTTTACGCTCCCGGATTCCCCCTGGTGAAGCAGGATCCACCGACCCTGACACTGTTGCTGTTGGTCGTCAAAAACTATAGGAGTTAA
CCGAGCTGTACGACCCTGGAAATATTTATAACATGGACGAAACGGGGCTCTGCTACGCTTTGGCTCCCGCTCGCTCCATTTGCACCAAATGAGCACGTGG
CGTAAAGAAGAACAAAACAAGAATTACTATCGCTCTCACGGCGAACGCGGATGGCACGGACGCCCTTCCCGCGCTGTTTTTAGGCCGAGCGAAGCAGCCC
TACTGCTTCAAGAAACGCACTGCAAAGGAGTTAGGTTTCAACTATTCCAGCAACGCAAAGGCCTGGATGACAGGTCAAGTATTCCGACAATGGCTGCTCG
ATTTAGATCGAGACATGCGTGCACGCGGACGGCACATTCTATTGCTCGTTGATAATGCGTCTTCCCACAACTCAGGGGATCTAGTTTGCACTAATGTCCG
TGTAGAGTTTTTGCCGCCGAACACTACCGCGTTCCTGCAACCGATAGACGCTGGAATCATCGCTGCGTTCAAGCAAGCGTACAGGAGGAAGCAGTTCCTA
TGGGTGTTTGACAAGATCAAACAGGGAGAAGTTATTGATAAAAAGGCGTACGTAGTCGATCAGCTACAGACTATGGAATAGAGCAAGGAAATATGGACTG
ATATTCAAGGAAAGGTGACGGTCGCCAACTGCTTTCGCCACACAGGTATAGTATTTAATGGTGTGAAGGAGGGTAATAGTGAGACTGAGTCGACTAGCTA
CGAAGCCGACGTCGCAGTAGAGGACATCATAGTCCGCGCTTCACAGTTGACCTTGTGGATGCATTACATATCGATCCTTTCTAAATAACATATCAAATCC
TAAGATAGTGTCGGACCACTCTACCGGATTGGAGAGAGAAATCTGTACTTGCGTCTTGCTGGCAACAGGAATTCTTCCGGGTGTGTGTAAAAGATCTCCT
CAAACATTTGCTGTACGAAGTCTACTCCACTGTCAACTTCCATGGCCTGTTTCGGTGGTAAGTTCTGAAATTGATCCACCAGATACGCATGCATTTCTTT
AAAGCTGAGGTCTTCCATTTTCTCATCATCACATCGCGGTGGTTCTCGTCCTTCCTCTTTCTCCTCACGTTCCCCTCCTTTTAACTGCGCCTCATTTTTT
GTAGTTTTTCCTCTCCCTCATACTGCTGTTGCTGGTTCCATTTTCCTTGATTCTTGAGTTCCTTTTCCGAGTTCCCGGGGTCAGCCGGTTTCAATGGCTC
CTCCTTCTCTTCCTCCTGTCCTGTGAGATCAATCACCACTGTTGTTTCTCGTTCTGCGTGATTTCCTACAGGATGCATCGTCCAGTCACTTCTCCCCGGT
GGGTCATCCTGCCCCTCCATGCTGAGCCTGTGGCGTTCCGCGAGCAGATGGCCGTGCTCCAAATAGAGGCTCGTATACTCAAATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGATGACAGGTCA
AGTATTCCGACAATGGCTGCTCGATTTAGATCGAGACATGCGTGCACGCGGACGGCACATTCTATTTCTCGTTGATAATGCGTCTTCCCACAACTCAGGG
GATCTAGTTTGCACTAATGTCCGTGTAGAGTTTTTGCCGCCGAACACTACCGCGTTCCTGCAACCGATAGACGCTGGAATCATCGCTGCGTTCAAGCAAG
CGTACAGGAGGAAGCAGTTCCTATGGGTGTTTGACAAGATCAAACAGGGAGAAGTTATTGATAAAAAGGCGTACGTAGTCGATCAGCTACAGACTATGGA
ATAGAGCAAGGAAATATGGACTGATATTCAAGGAAAGGTGACGGTCGCCAACTGCTTTCGCCACACAGGTATAGTATTTAATGGTGTGAAGGAGGGTAAT
AGTGAGACTGAGTCGACTAGCTACGAAGCCGACGTCGCAGTAGAGGACATCATAGTCCGCGCTTCACAGTTGACCTTGTGGATGCATTACATATCGATCC
TTTCTAAATAACATATCAAATCCTAAGATAGTGTCGGACCACTCTACCGGATTGGAGAGAGAAATCTGTACTTGCGTCTTGCTGGCAACAGGAATTCTTC
CGGGTGTGTGTAAAAGATCTCCTCAAACATTTGCTGTACGAAGTCTACTCCACTGTCAACTTCCATGGCCTGTTTCGGTGGTAAGTTCTGAAATTGATCC
ACCAGATACGCATGCATTTCTTTAAAGCTGAGGTCTTCCATTTTCTCATCATCACATCGCGGTGGTTCTCGTCCTTCCTCTTTCTCCTCACGTTCCCCTC
CTTT