Description :
Non Conding Region
Location :
Scaffold_1:5922- 12689
Sequence
6767 bases(100 bases per row)
CGCATACAAGCGCAAACGACGTTTGTCTCTCTGCGTGCAAGCGCATGCATGTGTTGGTAAGAGAAAATCTAAATTGAAACTGGTTTTGCTTGCGTTGAGT
CGGTGTTTTGTGCTGCAAATCATGTGCATCCTGCTTGTCTCTTGTCGGAATTTTGTTTTGCTGGTAGTGAGAATGGCATGTGGGTGGAAGCTGGAATGAG
AAGTGTTCGTGAATGAAGGACACTGCGCGTTGATCTTGTTTTGATATTGGAGTGCAGGTGCTGTCAGTGCGTGTAGAACCTTGGGCCGCGAGTGCTGGTC
GTTGACAACTAGCCAAAGAGCCTTTGCGATTTTCCTCCGATTGAGGAACGGTTGATCTGGGACGCTCCAAGCATAACCTTAAAGGTGAACACGTTGCTGG
AGACTGAACGGTCGTGAACCGCGGGTTGGTGCAGCCAAGTTCGTTGGCGACAACTTTTATAAGGTGCCGGCATGGATAATTCTCGATCAAGGTTTCTGAC
TCAGTTCTGAGCCACAGGATTGGTGAAAGAACGAGTTTCCTTAACGATTGTCTAGCTGTGCTTTCTCATGAGAGCTCCATCCGTGTCGGAGCTGCGAAAG
CGTGCTAAGACCGAGAGCTTGCACTTGGTGCAAAAGGTCCACGTAGTCAAACTCAGCACGGGGGCGCTTTAAGGTGCTGGGGAGGAATTGATCGTATACC
TAAACTAATCCTAAAACTGCCTAAAATAACTATTTATGCTGAAATAGGTTTAACCTAATTGATGGCTAAAAAGAATCCTGTGTTAAAATTTATCACAAGA
TGTGGTAAAGTGCGCACCATAATCTTAAGGACAACAGTTTTTTCTTGAGATGTTGGATCTTTTTGTGAATTTTTACTCTGCAAAGCTGATTTTTTGCTAT
GCTGTTGAATTCCACAGGGACAATCTCGTGTGTTAATTTCAGCTTCATTGGACTTCTGAAAGTCCACAAGAAAAATAGCATAAATTTAAAGAGAGAGACA
TAAACATAAGGACAGATGGAAACAGAGCAGTTTGGGGGCGTTTACGACTGGATTATTGTGCTTATAGGGTCAACAGAGTGTCCTAGTATGTTATCTTGTT
GCCTTTGCTTCTTACAACTGCAAGGCATCTGTCAAACATCGAGTTAGAGAGCTTGACAAGAAGGTCAACTGAAATCTCATCCCAAACAGTTAAAATCGCA
GTTTTCAGCTCGCCAACTGACGAGTACTGGCGGATGTTCTTGTAAACACGACGTGCCATGATCCTCCATAGGTTTTCAATAGGATTCAAATCAGAAGAGA
GCGCTGGCCAGTCTATGGTGGAAATGTTGAGGTCCGCCAGGAAGTCTTTCGTCACACAAGCCCGGTGAATGCTGGCGTTGTCGGACTGAAATACGTAGTC
TCCATGAACATCATCAACAAACTCAAAAAAGTGGGTAGTAAGTGTCTGTTGGTAGTCAAACGCATCTTGGTTTCCTCGAGAAAAGCTAGTCGGGTCTTTC
CAAGCGATGACATCCCACCCCACGCCATAACGGACCCACCATCAGAATGACGGCTCCACGTAATATTTTTATCGTTTCTCAAGTCGTGCCAGTAGTACTT
GCAACCATCCGGACCATCCAGGTTGAACTTTTTTTGCCCGAAAATACCACTTGGCTCCAGCCCATGCGCAAGCGTATCTGACGCTCAACCCACACCACGC
GCACCATCTTGTGGTGAGTGGTCATGCATGGAGACTTATTGGCCTTCTCAAACGCAAGGTAGTCACACCGTTGAAGTTTGGGTTGCATCGTGTGAATGCT
TGCATTCATGTTTAGCTTCTGATGGAGTTTATTAGCTATGTACTCATCAGCTGCCGCGTGTCGTCTCAATCGGGCGCGGTCGTGGGTCTTCAGCAGCCGT
GGTCGTCCGAGGCTTTTCTTGGCCCCATAGCCTTCAGGGTTCTTTAAGAAGGCATGCACAATGCTCTTAGAACGTCCAACAGCTTTCGCAATGTCCCTAA
TCGACATATTCACACTTGAACACGCCAAAATCTTGCCTTGTTTGAGCTTGGTCAATCCTGGAGACTTCGGCATTGTTGTCGCACCCCCATGACAAAATCA
ACAATGTTATACATTTGCACAAGCGCTAACGCATTTTGCTGAACCTGTGAGCACAATAATCCAGTCGTAAACGCCCCCAAACTGCTCTGTTTCCATCTGT
CCTTATGTTTATGTCTCTCTCTTTAAATTTATGCTATTTTTCTTGTGGACTTTAAGAAGTCCAATGAAGCTGAAATTAACACACGAGATTGTCCCTGTGG
AATTCAACAGCATAGCAAAAAATCAGCTTTGCAGAGTAAAAATTCACAAAAAGATCCAACATCTCAAGAAAAAACTGTTGTCCTTAAGATTATGGCGTGC
ATTGTACCTGCTAAACGTTGGATTGTTAAGGACTGGGTGGTTCAAAAGGTCTACTCGACATCTGTTGGCTCACATGTCTCCTCCCTCTGCGTTCTCTGGT
CCCTCAGAGTCAAGACGAAGTTGGTGCGACAGCCCATCGTCCGATTTTAGTCCAAGTGCTACAGCACTAGGAGACCCATTCGACTGACGTGATCCCACCA
CGCACCTGTCATCAGGAGAAGAGGAAGGTGGCAGATTCAGGCACTGGCACTCAACGGGATCCGCTGGGCTGTGGTGATTGGGCCAATGACGACTTTTCGC
TGCTAGAGCAAGCGACATTATGTGAATACAGTAGTGAGTGAGTGGTGCCTTTCTTTTGTGCCAGCAAGTGAAAGCGGGAGTGGACGGTCGATCACTACTA
TTGTATTCCACTGATAGAGAGAGCAAGCGAGTGGTCCTTGCTCTTTTGCCGCATCCAGTCCGGGAGATCCACAACGCAAGTGGCAACGCTGCACAGTTTA
TCCCTCCCCCATAGGTGCTGATTGCGTGCAGAGACCTGTGCTTCACGTCAGCAGCCAGCACCGAAAGAAGGCATCATCTGCGCCGATCCAAAGCGACTGA
GCGATCCGAAATCTCATCTCCATCTGTCTTTTGCGGACTTACTGTTAATATGCGACGAAGCCTATTACAAAGATCGTCGGCACCGCCACGTTTCCGCCTT
CTGTCGTCCGCAGAGTCCCAGCCAATGCGTGCATGCGCGAGCGTCGATTCACGCGCGACCGCCGTGACGAAGCACTTGTGCTGCGCTCATTTGCTGCTCC
CACCAGCACTCGCCCACCAAGACGCCCATCCGCACCTGAGATGCTTGCGTGATAGGATTGGCAGCTGTTTGGCCAAACAGACCACTCACGAACAGATCCA
AATTGATAGGCAACCTGCCACATTGTATCATATATTGCAGTTAATATTAATGTACAACGTGCGCATCCAAGTATCGGTTTTGATCCATATATTATGTAGT
GGAGGCCGCCTACTTTAGATAATCCCTTCAAACCACATGGTCCAGCACACGCATTTTCTTGTGGGAGGATCCGTCCATTCGGTTCCGTCAACTCGCGCTT
TTGGGCACGTTCCCCTGTCACATGGCTCTTGGTACCCTCAGCGCATAGCCCCATTGGCGCAACGGCGCCTTCGCCCACCAGCTGGCGTCGGTGGTTGGCA
GCAATCGCGCGACAGAGTCAGGCAACTCGTGAGCCCCACTCATGCCCGCGTCTCTCGCGCCCGACTTCCTAGTCGAGATCGAGCCTCGAGCGAGGAGCTA
CTGTCCCAACAAAGGCAGGGGATCACTTGTCAATCTGCTGGGCGCTGCCAACAACAACCCCGTTGCCATCGCCGAACGCGCGCCGCTACTTGCCCACCAA
GTCCGACGCGACCAGCAGCCTCCGTTCACAATGTCCGCCTACAGCACGAGCGCCATATCGGCGACCTCGTCCAATTCACTCTTCGGTAACATGTTTCGCA
CCAAGCCGCTCCACGTGATCGACGCCGAGGAGAAGAAGGAGGACCTCGCACGCTCGCTCGGCATGTTCGACCTCATCTGTCTCGGCATGGGTGCCACGAT
CGGCAGCGGCGTGTTCTCGACTACGGGCGCCATCATCTCGACAATCGCGGGCCCGGCCGCGTTCCTCAGCTGGCTCATCGGCGGCGTCGTCTGCGTCTTC
AACACGTTCGCGTACATGGAGCTCAGCACGCGCATCCCGTCGGGCGGCAGCACGTACGCGTACTCGTACCACGGCATCGGCGAATTGCCTGCGGTCGTCG
CGGCCTGGCTTGTCTCGCTCGAGTACTCGGTCTCCGCTGCAGGTGTCGCGCGCAGCTGGGCCGACAAGGTCGAGGAATGGCTGATACTCGAGCACCCACA
CACCGACTTCCACTGGCTCAACCTCAAGCACGCCAACCTGCTTGGCGGCCTCATCCAGTTCCTGAGCATGGTCGTGCTGCTCATCGGCGTGCGCTTCGGC
AAGAACTTTGTCAACACGTTCACGATCCTCAAGGTCTCGGTCGTGGCGTTCATCATCGTGGTGGGGCTCGCTGCCATGGACACGGCCAACTTTTCGCCGT
TCATCCCGTCGCGCGCCCAGATTGACGGTGTCGCGGCCTTCGGCTTCCAGGGCGTGATCACGGGCGCGTCGCAGGCATTCTTCGGCTTCTCGGGCTTCGA
CGAGGTCTGCTGCTTGTCGGGCGAAGCGCGCAACGCCAAGCGCAACGTGCCCATTGCCGTCATGCTCGTCGTCATCGCCACCGTGCTCATCAGCGCGCTC
TGCTCGCTCGTGCTCTCGGGCATGATCCCGTACCTGGACGCCAGCAGCTTCGCCGACGGCTTCGAGTACCACGGCTGGAAGTGGGCCGGCACGATCGTGC
GCGCCGGCGAGACGGTCACGATGCCCGTGGTCGTGCTTGTGGGCTTCCTCGCGCAGCCTCGCGTCAACTACGCGCTCTCGTGCGACGGGCTCATGCCCAA
GATCTTCGCCCAGGTCGACAGCCGCCAGAATCTGTTCTGGAACACGCTCATCTCAGGCATCTTCTTCACGGTCGTGGCCACCGTCGTGCCCTTCGAAACG
CTCTGGGACATTGTCAACTTCGGCGTCATGATGTCGTTCATCCTCGCCAACGTCGCGCTCATGAACATCCGCACGCGCGACACGTCGCCGGGCATTGGCG
GCAAGTTCGTCGGCGCGATCGTGCTGCTCACGGGAGTCACGGCGTTTCTGTATCAGGAGGGTCACGTGAACCAAGGCTCGAACGTGTGCCTCGTGCTCTC
CATCATCTTCCTCGCGGTCTCGTGCCTGGTCACCATCGCGTTCTACGTCAAGTGCTCGCAGCACACGAACGACAAACTCTACTTCACGGCGCCGCTCGTC
CCGTTCATCCCCGCGTTCTCGATCCTCGCCGACTGGTACATGATCGCGCAGCTGAGCCACCGCGGCCTCTACTTGAGCATCGCCTGGGTCGGCGCCGCCA
TCCTCTCGTACTTTGCCTACGGCTACTGGTACTCGGCGGGCCGCACAGGCTGGAACGTGCTGCTCACGCAGCAGCGCCTGCAGACGCCGCTCTCGGGACT
CCACGCACCTATGCTCTCCGTCGAGGACGCCAAGAAGGGCAGCCACCACTACACCGCAGCCTAGGTTTTGTCGTTTTTGCCTGGTAAGATCCACAGTCAT
GATAATACAGAAATTGGTGTGGAATTTGTAGGTCTCACCTTTGCTGTCATGGATTCGCCGCTGCGCCAGTGCCTTTCGCTAAAGGACCGCTCTCCGCAGC
TCCGTTGCTCGCTGTCATCGCGATCAAAGCCGCCGAGAGGCCGCTGGTGGCGAGTGTCGAGTTGAGACGCGCCTTCATGATCGAGCCGAACTTCTTCATC
TGGCGGTACTTGCCGAGCGCGTTGCCTCCTTTCGACACGGACGCGTTCGCGCTCTCGAGGTACTCGTGCAGCGTCGAGAGCTTCTCCTCGAGCGTGAGCA
GCGGCTTGGGCGTGAAGCCGCTCTCCTGTTGTTGCTGCTCCTTGCGCTCTTTGTCCGCGATCGCCTTTTGGCCCAAGCGCGAGCAGATGAACTGGTGCAA
GCGCCTCGCTTTCTCTCGCTCGGTCTGCCACGTTGGCGTGCTCGTGCTGGTACTTGGTGATAGTGCAGCGGCGCCAGCAGGATCGTTCCGAGCATTCGCA
GCTCGCGCTGGACTTGACGCTGTCGCCTTCCCGCTCGTGCTGCTCTTGTGGCGATTCGGTGAGAGCACTGTGGCTGAGGACCCGCGCTTCTCGCGGCGAT
CGGGCTCCACCTGCGCGCAGAACTTGTACGCGTCTTCAAAGTGGATCACGTCGTTCCCGGGCAACACGCACAGCACCGCGTTCTTGAAGCTCTGCGACGT
CACGTGGAGTGCGCTGTTCATGGCCTCGGCTTCCGAGGAGCAGAGCTCGTGCACACAGAGAAACGGTTCGTCGCACACCGAGTTTTCGATCTCGTGCTTG
GACAGGATCATGCTCACGACGGCGAAAAGCCTGGGTACATCTTGTGAGGTATTGTCGAAATCGCGTGGTTTGGCGGGGCTGCTCTGATCGCCGACTTCAG
GCATCTCTGGAAGAGAGATGACGAGGTCTCCATCGTGCTGCGTGGGGCTCGAGGGTGCGCTGCCACTCGAGCTCTGAGCAGCAGCAGTAGCGATCTCGCG
CTGCTCACTAGTGCTCAGTGCGAGCTTCTGGAACGATGCAAACAGACCCGACACCTCTGCTGGTGATGACGCTGATACTGGGCAAGGCGCCGTCGTGACC
CCGCGCTCATATAAACTTGCACTGTGAGCCACCGGCATGCTCGGCCGTCGTCCGCCATGCGCACTAC