Description :
Non Conding Region
Location :
Scaffold_1:59176- 72018
Sequence
12842 bases(100 bases per row)
ACCGGTAGTGAGTGAGACTTGAAGTTTGATCTGAAATGAATGAAAAGTGAAGATAAAAGTGCATGCATTTCCTGGTCATTGAGGGCGAACTGCCGCTGCA
CCGTAATAGTTGTATTGCAGCTTGTGATGGTTGGCATTATAATAAATGTTTCTTCCTCCTTTAACAACAAATGTTTCTTCCTCATTTAATCGAAATCGCA
AGAGGAAGCTACTGGACGCCCGACCTCGCCACTGCTATATTGAGCACCCATGACCGGCTTAGCCCTCATCCATCCTATTTCTCAAGCTTTTTCAGCGCGA
GCGTCTTGTTCACCGTGGCATAGTTCACATATAGCAGCGACAACCACGGGTTACGCAGATTGTCGTTAACAATGTCTGGAATCTTCGAGAGAACTTGGTC
CCATTCTTCTCTCACAAACTCGTGTGTGCGCATGAACTCCGTCACAGGCGATACCGGGATCATCTGAATTCCGTGAATCGCGTACTTCTCAGGGCTGAAC
CACGTCGCGTAGTTCACGTTATTGTCAAACAAGATTCATGTCACTTTGTTGGGTCGGAACATTGCAGGCTGAGCGCGATTCGCGTCTGTAAGCCGTCTGA
ATAGCTCTCACGTTCAGCTTCACCATCAGTCGACCAATCGTTGCGAGCTCCTCGTCTCCTGCCACCTGTCCGAACAACGCCATCCCATAGTGAAAGTTCA
TATCCTCCGACGAACTCTCTTGATCCTTCCCATCTGCAAACGATAAAACGCCGTCCGAGTACGAATGGCCACGGAACCAGTCAAAGCTGCGGAATTTCGT
AAAGTAAGGGTCTCTCCACGATGGATTCGCCACATCGCGCACTAGAAAGCTCGCTATGCGATTCAGTTCCGCTATTCCGGACCATGTAGGCGCGAGTTTG
TTCATGATTGCAGCGGTCACGATCCAGTAGCCACAATGGTAGTGGTGGTCGTTGTACATTGTGTTACCGAAATCGGCGTTGACGTCATTAAGAACAAAAC
CCTGGGAGCTCAAAATTCCTCCGTACACGGTGTCATACTTCAGCGCGTACTTCCAGGAGTTGGTCACGAACGGAGCGAGAAAGGATTTCAGCTTGGTAAG
ACAGTGATCCAGATTTATTTCTGAATCGGGATCCGTACCGGCCACCGATGGATCTGCAGCCATAAGGCAAAGCGACGCATACTTCTGTGCAGCTTTGCCA
TTGAAGTAGTAGCTCCCACCAACGGCAATCTTCCACTTCGAACCGATATCCTTGACCAAGTTTTCCTTGATCTTGTACTTTTCTACGTCGCTGGCTGAAG
GCACGTGGGACGGATAAAAGGAGACTGGGATGTCTGCTGTATCTGTGATCCGCCACATGGGTGAAGCTGTCGTGGTTATCAACGCCTGCATTGACCCTCT
CGTTGTCGAGTACGCGGCTACACCCTCCACCTCAAATGCTGTCGACCTTTCCAGAGTATCCACGTGGTGAATCTGCGCGTAATGAAGCAGTCCACTGGAC
CCTGAGCAAACGCCACTCGTTTTCCACACGTAAGCGTACGTGTCTGCATCTTGCGCTTCAACGTCGCCTCCTTCCAGAATACAGCCAGAAGTCTCGTCAA
ATACGCTTTGTTTTTCTGGATTCGGGGTCATCGCCACTCGTACAGTTCCTGTAAAAGAATTAAAGCCTACCAACGTCGAGGATCCCTCGAGGTGTAGCAC
GAAAAGTAGAGCGTCCATGTCTGTCCATTGTTGAACCTAAGTACAAACTGAGTGGCAGTGCCAGTGAACCCCGACGCAGTCGACTGGCCATTGACTTTGA
GAATGGCGTACACAGTGTCGAGGCGTGGAGTGAGCGAGCTATACTTTGCCGTCACAAAGGCCATCCCACTCGCAAGTGTCGCTTCAAAGCTGCTCTCATC
ACTGGGGCTCATTTTATTTAAAACCGGTTTGCCTGTAGTAGAATTCCCGTTTTTTTTTCAAACATTCTTACAGCCATACCGTACATTCGTGCAATACCCA
AAATCTGTGGTCGTTCCTGCAACACTTTAGTAACGTTGGATCTACTGCTTCGGTTACAGGCTGACTGCACTCCACCAGTGCCTCACAGCCCTGTTCCTTA
GAAGTACCGTAGATTGTTGTTTACCACCCACGGTTCGTAGCGCTTAGCCATGGCCACGTAAGCATCCTGATCGCCTACGCTCGTTCGCTGCTTTGCCGCC
TTGTAGAAATAACGAGGTCCGAGCCGCTTCGCTTGCAATGCTTACAATTTACCAGCGCCCATGTTCCTCACGAAGTAAAGACCGTATTCCTGGGCTAATG
CCTTGCTCCTCTCTATTTTGACGGGATCCGTAATCCCTTTTTTCGCCAGATTTTTCATCAACTTGTCTTCAAATTGTTTGGGTGTCTTCCCAAGTGCTCG
AGCGAGTTTAAAGGAAGGGATCTCCATCTTTTGTCTCAAGCTGTCCATTCGAGTCGTGCCAATAAGTTTCTCGGTAAATTTTGCGGCTTGATCAAAAAAA
CCTCTGTCTTCTTCAGTCGACGAGTCTTGAAAGCCCCCCACGTTATCATTGCCTCGTAGGTGCGGTTGAGGCGGGTCCATCGTTGAATTCGCGCGAGCTT
GGTCCATGCTCGCCCTTGATTCCGACGTTTTGCTTAGCTCAGAGTTTGCACTCTTCGCCGCCACCATAGCGGTAGATTGCAGTAGCGTGATCAAAGCTAC
ATGCAAAAACCACAGTAAAATACGCATGGCTAGCACTCGTGTCAGACGTTGCTTTTTTTCTTGGAGGGTCTTGCGTGGCACGCAGTAAATTTAGAAGTGA
CAGTGAGCCCATGACTGTTCGGTGTGCAAGATAAGCTGCACTTCTCAATTAACATCCCCCATCTAATTCTGCGCTGCCTAATTTTCATGATTACGGGATG
TTACCTAACATGCATTTGTTTGTGCTGAGGAGAGATCCAGTGACGTGGACGTCCGTCTGCCAATAAGATAGTAGAGGACTCCCACGTCAAGTGCTGCTGC
ACAGCACTTCAGTTTACGCTGGACAGCGTAATACGGGGATGCATGGTTTATATTCATTATATGCTATCCTATTGGCTGGTGTCAAAAGTAAACTTGATTA
TGGGACGCGTAAACATGGACGTTCGAGCGACCTCATTGGCTGTAAATCCTTGAGATGTGCAACAATCAAGTTTTCCAGCCGGACTTTTGATTATGGGACG
CAAGTCACAAATTTTGGCCAAGCTACGAATAGGATTAGTAGTTTTTCATTGGTAGATAAGGATTGATCTAGGATTTGATATTGATAGACTTTAGGATGGG
ACCTGGATACTTGTTTGCGTGTCCTGGTCGCCAAGAACTACTGGTTGGGCGGCGGCGGCGCGCCGACGCTAAACTAACGGATCAATCAATCGCTTTTCAA
CTTTCCAACTTCCTCTCAAGTATTCTTCGAGCGCTCGCCACTACGCTCTTCACGCTTCGGGTCTTCGCATCGGCTTGTGTGGCAGATCCGCTGATTATTC
ACTGAATGGTGAAATCCGCCAGCTATATCTGAATATAGGTAATATTCAGCTATAGCTAGCGGATTTCACCGTCGTTGTCTGTGGTGCATCTATTGGCACC
GACAGGGAATAAAGATGACGGGCGCATCTTTCAAAAACTTACAAAAATCAGCGGTCTCGACAGCAAACTATTCCCCAGCCAAAAACCCATAACCCTTCCG
TACCGAGCGAGTTGAGATCGTGATTGGTCCTGGGTTTTAAGCTGGGCAAGTGGTTTTCACCCCTCCAGGCTTTTGTCACCGAAAAAGAGCTGGAATGGGC
CTTCATACATATCTAATCTAGTGTCAATAGTCACTATCGTAGGCATTTAAAGAGCGGGTTTTCAGAGCGCTAGAGCGGAGCTTTCAGGGAAGCACACCCG
TGCCGTCAGATGGGATCGTGATTTGGAGTGCTCAATGAGCACTCCAAAAACAAACCAGTACCTCCGTATGCTGAACACAATTTCCTAGTTTTTCATGACT
TTATTAACAACTGTCGCCTCGGCAGCATTTACAGCATGTTCATTGTTGCGAGGTGCCTGCTGTGAGCAGTCAGTCTCAACAATGGCTATCCTCTCAGATA
CAGTATGGACATTCGTCCGTGGCATATCTTTTTACATGAGGTTCTTGACTGAAAACGCACGGTTTCATCGCTATCCAGCTGCTGCCACTTACCAGCACAC
AGCAACTACGCAAGCAATTATTATAGCGGGGATAATCGCCATCGAATATTAGTGTTGACGCGACGGCATAATCGCCATCGAATATTAGTGTTGACGCGAT
GTACAATATAACGAAACGACAAATCGCCCTCCAGAGGGGCTTTTTGTAAAAAGCGGAGTGATCCGGAAACTCTTTGCATTTGGAACCTTTTGTTACAAAA
AGCAGAGTTCGCGGGAACTTTGTTACAAAGAGCGGAGTTCGGGCCCGGGGGCCGCACACCCAATAGATCTTTAGACGGTGAAGAGGCCCATGCAGTCGCC
GTCGCCACCGCCGTCGCCGCACCCTGCGCAGGGTCCGACGGACGACACTACCACCGACTCGGTGACCGAGGGCATGTGCTTTCCTGACCATAAGTCGTGC
ACGAAGGCTTTGCGCAAGTATGCAGCAACACACGGCATGACCATCAGGCTCGATCCAAAACAGCACGGTGGTGTGATGCTCATGTACAAGTGCGACGGCG
GAGATCAATGCCGCTTCACGGTTTTTGCACTGCGAGGCTTGACCGGCATTGTTGGGCCGAAAGCCCAACGGTTTCCGCCGCCCGCAGGGCGGCGGCAACC
CCCCCCCCCCGTGTTTTTTTTAGTATCCATTTATTCTCCGATTTGAACATGGCGGAGAATGCGGCTCGTGCTGCAGTGAAGGAGGCAATAGCGCTGCGCA
TGTTCCCTCCTACTCTGCAGCTACCTGAACTGGAGAAGCATGGTCTACTTTCCACCTGGCTAACCTACCCAACGATTACCTAGACTACTGAGTGTCTTTC
GCCTTCTCGTGACGCGGTGTGCATTGTGGAGGGCTGTTGCTGTACTCCGAGGGTGACGGGCTACTCAAGTCGCATCGTGCACGACATTGAACACAAGACC
ATACTGTACTACGCAAGGTACACTTGCACTGGTGGCAATGGACGGACATTTTCTACAATAGATGACGATTATCTTTCTGCCTCGAAAGCTACTCTTCTTG
CTTTTCGTTACCTGCTCTCGTACCAGTCTGGAATATCGTTGGATTTTTTCGACCTGGTGTACGATAGCATGCTTACCACTAGAGGCATAGCTGGTGCGAC
CGCGAACGTAATACGGCGACGCCAAAAGCGGTATTACCAGATTTTCAGGTTGGCAGCGATGACTGTGGAGACTCGTAAATTAGAATACCAAAACTTTTCA
CCTCCTCTGCTTGATACAGTTGAGCAGTACATGCAGAAGAATGCTTGCCTTGACGAGGAGACGTTGAGAAAATTTGGCTGTCGCAAACGGAGATTTGCTC
TAGATTGTTGAAGGCGTACATGGCCCAGGCTGAGTGCAAGCGAGTACTTCGTGTCGATCATTCTCAAAAGTTTTGCAAGAACTCAAAATCTTTGGCTCGG
ATAACTCAAAAGAGCAGTCGTCTCTCGTTCGATTGTTGATGTTGGTTCAGAACGAAGCCGGCGAGATAGTAGCGAGAGGTCTCACCCAATCTGAAAATCA
TGATGAATCGGGCGCAATTCTGGAGACATTGGTGCACAAAGTGAATCATGAGAGTGATGATGAAATGGTTTGTGTGTGTGACAACGCTGTTCAAACCCGT
AATCTGATCACGAAAGTCTTTGGCGGTAGAGTAGCGACAAAACAGGACCTATACAGCGCTTTACAGAGAATGTGAAGGAGCCATCGGAGCGCAAAGCTTT
GGCAAAGCATCTATCGAAGGCGTTGTATGACGTGGAGCGCAAGCTGCGACCACCAGAAGACATGGCAAAACAATTTCTGACTGTACTGCAATCTGTATCT
AACTCTAGTGTGCGTAACATTTCCGAGTGGACGAACTCAATTCAATCCAACCTGCAGCAAATTCGAAGTAGAGATCAGTATGTTTCTGATTGTGAGTATC
TCGAGCGAGGCGAGAAGATTCGAGTTGTTTCGACCAGTCAATTAGAAGCGATTCACTCGAAACTACGCAAGTTGCTTGATCGAGTAGGGTTGGGCTGCGT
ATCCTAGATATTTTCACGCTCCAGGTACGCTTTACACATGTGGTATGTGAAACCATTGCTCGCGCTAACACAAACCTATGATATTGCGCAGCATAATTTT
AAAACAGGAGCTAAGTTCAAGCGCAACCCCAGTTTCACGGAGTTCGACTTCATCACCTTGTGCAAGACGGCCGTCTTCTGCAAAGGCCTGCTGCCGGATT
CGCCCCAACTAGAGTTTATTTATGCGCTATTGTCAAAACAACCGCTCGAGGTTAGCATCCAACAGCACTTCCGCCCGGGTGGTGAGTCAGTTCCTGTTGG
AAAACCGTGGGAACGTTTATTCAGCTTACTTCCTCTCCGCACTAACGCACTCGAAGCCGTCATCCTTCGCAAACGGTCCCAACCCACCGATATTAAGAAG
TTGATGCAGTCAGCGCACGTGACTCGTAGAAGCATTCCTAGTGATGCGTTTGTGAAGCAGCTTGGGCTCAACCCGGAGTATGAATCGACGGCTGACTTCA
CGGCTGACGAGTTCGTAGTGCTGGAGCAAACACGCGGGGAACAGCTCGCACTCGATGGGAAAATATATAAGTGGCGTGAATGTCCTGTCGTGGCAACTGT
GATGTACAATGCTGCCGTAAACGAGCTGACTAACCCGTGTCTGAAGCTGAAGAAGCGTTGATCCCGCTCAATTGAAAAACGTTCGGCAGCTGTAGATACG
AAGTGGACCTCTGGTGGAATTCGACCTACAACACCCTACATTCTTAAAGTCGATCGCAAGACCCCAGTGAACGACGAAGTGAACTCGGATAAAGAGATGG
CGCTTCAAAAAGAAATTTATAATTTACTTCGCCAGTCAAACAAGATAAAAAATGTAATCGGCGTGTTCTGCAACGTGTACGACTTGGCAGCGCACATGTG
TCCGACAATCACGCCAAAGTCGGAGGATTTCTTACGCAAACGCTGGAATGCCCTTCGAACCGCTGAATCCCGTAAGAATCGCACGAAAGTTGTGCTGCGA
GTTCCGCCTGCAAAGAAGATAGAGCAAGACCTCTTTCCCCACGTCGAAGAAACCCTAGCAGTACCGAGCGAGAAATCTGCTGAAGCGCAGCAATGGGGTA
CTTCAATTATGCCAATAGCTGCACTGGTACAGAGGGTAACATGAATGACCGTGTCTTGTGAGGCGTGTTGCAAGTCGGGAATGCCTGCAACGAACAGAAT
GAGAGGTTAGCTTCTTGTGTGGCGGTCAGTGCGGCTGGCGATGTCTCCACACCATCCTTACCACGCGCTGTCAGGCGCATAGCTGGCACGGAGATCGAAC
TGATCGACGACGCCACGCGCGAGCATTTACGACAGTTCGCTGCATCATTGCCTCGGAGCAAAGGTAAATGGGCGCTAGTCTTCTCCGAGTTTCAAGCAAA
GCATCCTACCACGAACCTGGATGCAGAGAAGCTTCGTTGCCGTCTGAAGGCCAAAAGGCAGTCGCGGAAGCGGGCATTGGACCCACCTCCACAAGAGCAA
ACAGCGGCAGCTCCAACCCAACTCGCCGCCGAACCGCTGAAGCGATCTCGCACCAAACCTCCCGGACGCGCAGCATGCCAGAGTTGTCGCGATCTCCACC
ACAAGTGTGGACCAGACAGCACTAACCGCAAATGCCAGCACAGACAGACAGAGGACCCGCGGATTACAGCGTTCTTCGCAGCGGCAGGACGCGACCAGGC
CGCGGTAGGAGGTGACCAAGCTAAGTAATCTGCTGCAACACACAAGACTAATGGGAGGCGCCAGCCGCGACTTTGTTAGTGACAGCTAGTTGGCACAGCA
CAACTTAAGCCTCAAGGAATCCATCGTGTACCTGCTTCACGTTTTGTCTTTTGAGTCCGTTCAGCTGGAGTCGGGCATCGGTGATTTTGATTCGGTAATT
ATATATTGGGGTCACCATAACACTTAGCATTTCGGTGCTCAACGGTGCCAAACGGTGCCCGCCGGTCGCAGTACAATCCCACGAATTCCGGTCAAGCCCC
CCGGTCAAGCCCACTGCGATCATAGCGTCAAGGATCGAGCGGCTATTTCATCAGTCGCAGCATTCACCTGGTACTCACTCGTAGGAAGAGATGGGAACAA
CATGAACATTATTTTGGCCATTGCAGTGTGCGCTACGGAGAGTGAGGAGAATTGTAGATGTTTTTTCGGTGCTGTTTTTAGGCGGGTGTTGATCTCAAGC
TCAAGGCCATGCCGCTTTTCTCGGATCGGGGTTCCGGAATTCTGGCCGCTCTGGAGAGACTAAACTGCGGTGAGAGTGGTCACAACAAGAGAAGCTGTCC
CTCGTGCGCGTGCTGCGCCTGCACGGTGTATTGTGTTACAGCACCATGATAATTCATAATACATGTTGTTAGTGGTGACAGTTGTGGAAGACCGAGCTCA
AAGTTCTTGTAAGTTTGATGGTGCTGCAGGCCCCGGGCCCGAACTCTGCTCTTTGTAACAAAGTTCCCGCGAACTCCGCTTCTTGTAACAAAAGGTTCCA
AATGCAAAAAGGTTTTACTTTTTTACTGGATCTCGGTATTTTAATACTGTCCAGGTATTATTTTGAAAACCAATTAGGATGTCTTATTGGATTGTTAATC
CGCCGATTTAGTGACTTAATAAGACCGACGACCCCCGATTAGATAAATCCGACCTCCTAATTAGACGATTTATTCTTTAGATTACTACCTGGGACGACTT
ACACAGTAAGAGCACATGAGTCGGATTTACGTTTGCTAATCGGCCGATTAAGCCAGAGCCAGCCGATTTGCTTGCTATTCAGGCAAAGCGACGCATACTT
CTGTGCAGCTTTGCCATTGAAGTAGTAGCTCCCACCAACGGCAATCTTCCACTTCGAACCGATATCCTTGACCAAGTTTTCCTTGATCTTGTACTTTTCT
ACGTCGCTGGCTGAAGGCACGTGGGACGGATAAAAGGAGACTGGGATGTCTGCTGTATCTGTGATCCGCCACATGGGTGAAGCTGTCGTGGTTATCAACG
CCTGCATTGACCCTCTCGTTGTCGAGTACACGGCCACACCCTCCACCTCAACTGCTGTAAACCTGTAGTGGCGCCATGGGAAACCTATCGGTCGAAGGAG
CGCAATGAAGCTCTGCCTCTGGTCTACCTGTTCATTGGGGAGTACGGTGAGGGCAAGGACTACCTGTTGGTTCTGAAAGATGACTTCTCGCACTTGTGTG
AGCTGGTGAAGTGTGCAAGCCCTGACTCTGCGACTGCTGTCAGAGCCATCCTGGACTGGAGTAGCCGCTACGGCATGCTTAAGGTGCTGATTAGCGACAC
AGCGACGCACTTTAAGAACCAAATGTTGGAAGAGCTGTGCCACAAGACTCAAATGACACAGAGTTTCACTTTGGCTTACTGTCCCTGGATAAATAGCAGT
ATTGAACGGCTAAATCGAGATATCCTTCAAGTATTTCGAGTCATGATCTTGGAGTTCAAGGTCGAGCAAGCCAATTGGGCGACACTACTCCCTCTCGTAC
AGGGCAACCTGAATCATAGCCCTGTGGCATCGCTTGCCAATCACTCCCCAGCAGAGGTGTTTCTTGGGGTTACAGCAGCTACACCATTAGAGAAAGTGCT
GGTCGGCCACGAGGCGGCGGAGATGAAGGTCGTAAAGACGGATGAGCTTTCTCCAGACATCAGCTCAGTGGTGGACGAGCTACGTGCATCGATGGAGGAT
ATGCATCATGACGTCTCGAGCGCCAAGGAAGGCCATACCAACCGCAATAAGAAAAATCAGCGTGGTGCGCAGCAAGAGAACTTTCACATCGGAGATTACG
TGTTGTGGCCCCGTATTGATTCCGAGGTGCACGTCAATAAGCTTGCGGTCAAATGGATTGGACCGTACCGTGTGATTGGTGCTCAGGCAAACTCATTTGA
GATCGAACATTTGCTGAGTGGAGCCACTCGCAGGGTGCATGCTTCGAGATTGAAGATGTACGCCGACAGCAGTCTCGATGTCAGAGCTCGGCGGCGCTTG
AGCTCGGCTAAGCCGGATAACCTGTCCGGATAACCCCTTGAACTCGGGCTGAGCCGGATACGGCGTGTCCGGATAACCTAACGAACTCGGCTGAGCCGAA
TAAGATGTCCGGATAACCCAGTGAACTCGGCGGAGCCGGATAAGGTGTCCAGATAACACGGCGAACTCGTCGGAGCGACCCTTATACTCGACTGGGCGAC
TCCCGGACTCAATTGGACCCGGTTACCGTATTTGGATGGTACGTGGTGCCGTTTTGCCGAGCTCGGCGGCTTGAACTCCCCATGACCTCGGCTGAGCGTG
TCCGGTGCCTTCCTGAACTCGGCTGGGTCTTCATCACTGGGCCTGCCACGTGTCACCAGGTCGGGGCCGGTGTGCATTGAGTTTCTGACACCATCACCCG
CGTTCAGCTGTCCATCAGCCCACTGAGCTCGGCGGACGGTCATCCCGCCGAGTAGTACTTGGCTCCTGGTACGTTGTTCCACTGCGGCCTTAGAGTGTGA
CACAAAACTTGATGTTCCCCTACACCACACCTCGACGCCACCCATTGGCGGAGACCCCCATTACGGAGGGTACGTCGGCTCCCGGAGCCGACGAATCAAA
TTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATTAGATTCGCGTCAGCCTCCACG
GCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAATCGGGTATCGACCTCCGAGGTCAACACAT
TTTCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGGCCCCAGGGCGCTCCGGAACAGCAGCGTTAGGCGCTGT
CTCGGTGGGGAGTCGCACGCACCTGTCGGTGTGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGA
TGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACGATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGGTCTTC
ATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACCTCCAGCATACTTCGAGGTATCTTTAAATCCTCG
AAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCAAAGCACGAAAAGATTTGCTCTCTCTCATCGAGTTCACGT
TCAACATGAAAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTCCTCACTGGGGGCTGCAGTCCTCAGTTTCGCATGTCCGAGTTGGACATG
CGTGACTGCTTCACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTGTTTTGTTCGTTCGCGCCGATGCCCTGCATCGCCGCGTCGACCACCATCTC
GGTGCACGGGTGCCGTGTACTCTCGGGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCAACTGCTGGGGTCCAGCAGTTGC
AGCACTCGAGAGGCCCGTGGGTAATGGGCCTCCCGTCCTCGCTACCGGGCGTGGCTGTGGCCTCGGCACATCTGCATGCAGTTTACCCTGCCGCAGGCTA
AACTCCTCCTGCATTGCAAGAGTAATCGCAGCTTCGAAAGTGCCTGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGTCCCTTCATGA
ACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGCGCGTACGCATGGACATCGTGCTTACCCTA
CTGTAGGTCGAGTAACTCTGCCCTCGACCCAAACTCATTTTGCGGGGGCTCAAACGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCAC
GTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGCAACCTTGGACAACGGGTCGACGATACGTC
GAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGTTTCACCCTCTCTTCCGACATAGTTGCTCACATTGAGCTTCAACGATTGCGCGCG
TGGTGTCGCCCCGGACGACACCGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGC
GACGCAGCATCGTAACTACAGCCGCCTCACCAATGACCGTTGAGGGAGGGGTGGGCACAGTCAGCGCGTGCAACGTGAGTTACAGGCGTAGTGGAGCTTT
CCATGGGCACCTCTGTATCCATGGGAATCAGCTCCACATATCCATGGGAATCAGCTCCGCGTTCATGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTG
GACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTGCTTTGGCTCACTACTTTAGCTTACACGTCTGCGCACGTGTGTGAGGAAGCGTAGCTTACTTTA
AACGAGAGTTAATTATACTCGGGCCTCCGAGTATAGGTTAAT