Description :
Non Conding Region
Location :
Scaffold_1:59052- 59273
Sequence
221 bases(100 bases per row)
TTGCTGTCGGGCAACGCAATCGTAGCGGAAATCTCCTGGCGCCCGACGCGTCTGGCTCATGCCCTTGCTTGCTTCTTACAGTAGCAGGCAGGCCATTGAA
GCCGAGCCAAGCCCGCCACTTCGCAGCACATAAGGGAATTACACGACAGGCAGCGTACATTAGCTCGGTCTGCGCTCGATGGGTATGACAGTCCACGAAA
CTGCGGCTCATACTATAGCAT