Description :
Non Conding Region
Location :
Scaffold_1:5876- 6402
Sequence
526 bases(100 bases per row)
GTGATTAATACCGCGGGAGCGATGCGGAGGTCGGTGCTCTCGCTTTCGCTCAACTGTTCTTTTGATGGGGATGACGATGTCCAAGACGGCTTCTACGGCT
GCCAGCAGGCGTGTGCAGCTCCTGAGCAACTGCTGGTCAACCAGGCTGCATGGAGCATCTGGCCGTGTGACTGGGGCACTGCCGAGGCAGAATGAAGGTG
GATTACGGAGAGCAACGCGGGACGAGCTACAGTTGTATACGCTGTCGTATAGTCGTGTATACACATCTCACCCaCCAACCGGCTCGAAGCTTGtGGGTTG
ATCCGGATAAGGTATTGGCAAGTATACGCACATCCGGAGAAGTATGTCGCGAGGAATGACGCCCAGACGCAATCCTCCCATCTCCGTCAAGAACAGAGAC
CGCACTGTTCCGAACATTGCCAGGTGTTCAGACGCTCGATGCAGTTGCTGCTCGCAATGACTTGTGGCTCTCTGCCGGCACTTGGCGATTTGAAGCACCA
CGTGCGACGAAGCAGGAGCCGTCCTT