Description :
Non Conding Region
Location :
Scaffold_1:58504- 59309
Sequence
805 bases(100 bases per row)
GTTAGAACTGGGAGACTGCGATGAAGAGAAGAGGCAGAGAGCGAGTGAGTGAAATGTGCGACACAACAAGTGGTGGTTGGTAACTTGCTGGACGCCGGAC
GCAAATGCACGAATGCCTGAGAGCTGGCTGTAGTGGCTTCTTCTTTCCTGCAAACCTATTTTTGCCTCGTGGTACTCTCGGCTTTCGCGACAGCGGAATC
TGGTGGAAAAGCGTGGACAGTGATCAGACGGAGAAGCATTTGGATTGGTGAGTAAGCCCTGATGGCCAGTGCTTTAGCGCTAAGAAGGGGGCACACGACA
AGACAAAAAAACCTTGATAGGTCGGAAATGGGCTATTTTGCATCGTTTCAGCGCATAAATAGCGAACTTACCAATGCTAATTATACCAAGGATCATGATG
AGATCGCACGCACTTCACTCGTCCGTGACCACCATTTGCGATCTCGCGGACCTTCTTGTCTGCTTTATGTCGAGTTTTGGCAGCAACATTTGGCAGACGC
CGTATCGATCTAACGTTGTGAGGCTCTTACCAGAAAACGAAACGGTTCTGCGCTTACTGCTCTGCATGACTTCACTCGAAACTCCATCTATCCTTTTGCC
GTACTGGATGACCTAGTGGTAAATCTTCTGATCGTAGCCACATCTGCTCACATTTCGTTAGCTCAATTCTCAAGGAATACACAGCATAAATGCATCTTCG
GATTGTAAACGTGATCATCGGAACGAAGAGAGTTGCATTCGTATGCGGTGTTTACATGGCTACGCCAAGCGCGCGTCGTCTTTTCAGCTGCCTCGGTCCA
CGCTT