Description :
Non Conding Region
Location :
Scaffold_1:5829- 6119
Sequence
290 bases(100 bases per row)
CTCAGCTTAATGCTCTTGGTCTCTTTCAAATACCTTGTAATCCATTTTGCCAGCTTCGAGTCACTCAAAGACGGTTGATGTGTTCTACTTGTGGCCTTAT
GTACAGCGAAGCTGATGTCTGGACGTGCATCGTGCAATCCAAAGTAATCTCCCAACAAGGGACTGAAAATCGCGAATAGTTGGTATACCTCCTTGACCTG
GTCGTGTCATCAGATACACGAAATCCTTCTCCACCTCGTTATTTTCTTCACCAATAGGAGCACACGCCATTCGCATCCATGAACCCGTGT