Description :
Non Conding Region
Location :
Scaffold_1:58287- 59213
Sequence
926 bases(100 bases per row)
GTGAGACGCAAGTGAGAAGGACACGTCTCTCAACCCAGAGACGCAGGACCGAGGATTGGGACTTGACGCACGCACCATTTCAGCGCCATCGGCCACGAGG
AGAAGACGCGCCAGCTTCACGACACGGTGGATCGCACGCGTCTGCAGACGGAGAGGAAGAGGCCGCTGGCAGGACAGCGGCGGACGGAGGCGACTGCTGC
ACGCGGGGTGTCGGCTATTGGACTGCAACTGCGACTTGAGCGAAGAACACGGGGTAGGGCGTCACGTTCCTCGAACTTGCCCTATGGCTTTGAAGCGTGC
TGAGGCACTGAGGATTTTGCGCCTCACTACCTCATCAAAATTTTACTAAAACTTGCATAGGCAAACATTAGCTAGACTAATATTGTGGCAACGAGGACTC
CCAGTTCGACCAGCCCATCGCGAGTTGAGCAATGGACCGCTGCTCTCAGCTCCGAGCAGGTCGAAACCAGCTTAGAGAGTAGTGGTTTTCTTGACACCAG
CGAGAGCTGGAGTTCCGAGTTGTACCAGGTTAGCTGCTCATCACACGTGATATTCAGGGGGGGCATCCAGAAGGCATGGACAGACCCACCCCCGCCCACC
CACACAGACACACGCACACAATCACCTTCCTTATTATTAATAACATCGACTTAAGTACCCCACTCCGGCATCATCGCGATATATGCTGCAAGGGGTCAAA
CATGCCTTTCAACAACAAAATTCCCGCACATGTACTACACTGTAGTAGTATACATAGAAGTATGAGGCGGATCCTCAGAGCGACTTTAAACTAGTCTATC
TGGCTCGTTTATACAACACCGCCTCATCGGGAAAAGGCATCCAATCAACTTCTCGCTGGTGATTGGATGCCACGCCAATGTTGGCAGCCGAGGGTGGACC
TTGATCGCGCTGCTTGGTGGTGCTCA