Description :
Non Conding Region
Location :
Scaffold_1:58259- 58826
Sequence
567 bases(100 bases per row)
GGAATTCAGAAGTACTACTGCCTGGGAGCTGCGACATGCAGATATTATGTCAGGGCGCAATAATATATGGAATATTGCTTCGTCGTAGTTGGTGACGACG
GCAACTACCTCGCGCATCTGACCTACTGAGGCATCGATGCGGATACAAACCACGTGGTGAATGGCGGCCATATCCAGCACTTTGTGCAGCACAGAGGGTC
CTCGCATGCCAGCTGGACACCAGCCCGTGGCACGTGGACCGTAGCGCCCAGGTGGGTCAAGTATACCATACCGCATATGTGCCATGGTTGTCATTACTGC
AGGGCACGGAGCACTTGCTGGGTAAAACATCCATGAAAGTCGAGTATTCAAGTCCGTACAATCCAGTCGTTTAGATACAAGTTGGGTGCATCGATTGTTC
CTGCACAATGAACAAAACCGCGGCATGGAGGTGAACGAACTGTATCTTAAGTTAACGTTACCTAGAAGGCGTCGAAGAGATTTTACTTCCATCCAGGCGG
CGAACATTTGCAGACCCAGAACTTTAATTGCCAACAGGTTTTTTCGAACTCCAAACGATCGTGGCAA