Description :
Non Conding Region
Location :
Scaffold_1:58234- 62525
Sequence
4291 bases(100 bases per row)
gcccatctgcagagcgactaaaccattttgcaacaggttgaagccatcgatcgattgtcatcattgcggtcgtaaatgagttgtgtatcttttgtcttcg
aagtcgaacttcgaacttgcctttttgccaaggatacacttcatggattaccacgactgggagatgtaacaagttgcttctgtcgtcatcatgctacatg
tatagtactcggaaccaaaatgaacccacgaacaagatcggtgggtgcatttggtgagtaattttgctgcttgacaccgactcggtgcaagtctcgtgct
ccgagatgtagccgtgcggctccagaaacaacgtggcgaaatagactgctttctgatctctgggatcaacccaggcaaggatgaacaagacctctccctc
ctaggctccgagttccagcacacacgttgcagcacgccattccatggaccagcaggctgggttgtcttagacaactcgccttgtttgtggatgtgtacca
cgtatccatggtggcattatttaggatctagaggtcatacttccatgttggttgcactgcaacttgcagcagcaaatactactagtacttcaaaagagca
atgagcactggtaatttaccagcgctgattcccacgtggcaccggcatgaactacttgcagttatgggactgagctcatgacgtgttatgcccagaatcc
catcacatcgaggtgttcaaccgcacccacactgctccatatcttggctaatgacatcacaatatcacccgttctgcgatcctactacatgtaccataat
gtggaaactccgtacgtttgagagctagatgatcaaactcagatcatccgtttgcaaagttccaagataataatgaagctatgagtgcctgatcattcga
gctttgccacttcgaagcctagtgggttgggaaaacagttttgtcaaagcaggtgtctgaatccagaggagttacagcgataggcaacgtagtagaagcc
ctgaacagtgtacccaccggtccggatgacgatggtggtggtggtggttgagcacctcccttgaacgtggtcattgctggagctttaggccattcccaaa
ttgtcccgaagcccgcgacaaggcctctgcatgaatgccccaacacacgccgtctccaacgcgcacactgccacggaccattcccagaggacgatcgtgg
cacaacgatgtggacgacaggctgacccggaagctcatgatgttgcggctacgaaggctgcatccggtgctcgcagggaccaaatgcacgaccacaggca
gcaatggtagcaccgttgtggtaccgtccttggtacaacggctcgagtggatgctctacaacgccgcccactcaatgcatgaatacacgcacgaacaatc
gttggaacgccgagtgcaggccctcgtgacccagctcgagccaaagacaatacctggacagaagcaacaaacaggcaaacgaggcagaggcattaatgac
gaaattgagccacgcaagaagcgacagtctatcggtcaccaggctttagcaatatcgagtgacagcaacaggtataccaccgacaggagcgtgtttctac
tggataatgacgtggatcttgtaggtctggtgctcagttttctctcaggacggacagtgcttcgactgcggtctgtgaacaggttcatgtgtgagaacgc
tccatcgatggtgagtacgctgcatctcgagacgcattcaccagcactgcagtatttctcgagtggtacgttgacaacgttgctgcttcgttgcagcaag
ctcgttagtctcgtggtaaccagcaagctccgagattacgccgaggcagacgaaccggataaaagaagcacctcagcaatggtgcatcgtcgaccgactt
tcatccgtccaactcaccaggacagcaacctccagaacggcttacttccaggtgaattaatgctgagagatatcacgcgagcgttcgagcaaggagcatg
cccccaattgcaggagctggaccttggatcgccgctcgagtatttcgcagagagcgacgacgtattgaagtgtttggaagcattcgcaaaatggagacat
cacagcacaggaattcaccgacacaaagtgaacgttgcagctggatctctccgatacctgcggcttgactccacttaccttggtgacgcgcgtttgaatc
gtctggcggatgtatttgaccaggctgttgatagcaactgcgctaactgcttcggttcgttgaagacgctggtgttgcgaaacaatttcatcggtgaggc
cggctgccaggcactgctgcgaattctgcggtgtttaccagcgctgctagtgttggacgtgagcgggaacatcctcacagacctggacgcgcttgcgctc
gccgactggatctcctgccgggcggaagacttcaaatcgagtccaaatcttcgcacccagaacgggtattcgagccttgagcctaggagaaggtcagacg
taccagccgtccaactgcggacgctgctgctgcaggacaacttcatcggccaggaagggctggaagcgctgtcctcagcactcaacgcccggctgatacc
gtcgtgaactgtaattttagggtcgagtgcagtatcagtgagtcttattaatcgagggaaatgaagaggctacagattgatcaaatgcacaaggcaagtg
caagacaaaagtacattgtacgtacatcatttatgagtgatcgttctgttgtgggacttgcgattggcgagaaaaacgcacatttgcgaccacctgaagg
tccccccgtcatcatcgatcgtaaacaccgaaaaggcgtttcatcgttttcacaattatattaatttatgagggtacacagaaacactgattaagcattt
atcaatataaagtataaggttagcgaaaatccagcaaacattttacagaacattcgtcttgacactccagctcttcacctgactcctccaagtccattgc
gtgggtggcccttgtccaaccaatttgtggcacggtgggtaaggtacagtagtgtatcgcacaaacttgtagtgatgagtaagacctcctcgtcgcagga
tttttaggagagagtgcacttgcagtgccaacggatttgacaccgagacattttgatatcgcgtttctctgctttccaggcaagcagggctcgaatcgtt
gtcttggggataaccaccggcggatgtatacgcacacaacgactggtgcaccgaaaactcctctgtgacagtttgtagcctttgggactcgatgcaggtc
gaccgtggcgtttgccctgccagtgcagcttggaagaggatatctcgtggtgaagggctactgcatgtgtgttcagcggcgattcgggctctctcggaat
tgcaaaaatctacaaatgtaaattttgggcgtttcgaaatattccgcagtgatgaatatcatctcttgtcaaaaattaatcttcagaaaagtatcttctg
ggcttgcgagcgcgtcgtagccggagccatgccggcttctctcagattcggtcatctgatacagcttcgcatcgcaaagcgtggcgtagctatcggccag
ccgtcgacgtacagcctggttgggttggcaaccagcgctgctgttagttgactcgcagacaattcttgcgcttcagtgcatatctcatcgtatggaatcg
cttatatacaatacctgcaatatcgaatgttctagaataaacgactcgcttcaatatttgcatctaatactgaaaaatctattccgagccgttctttagt
accaaaacgacacctctgtatctttatgtctactcgacattgtcgagtggtcgaaaaataaaatgcgctaatcgcgctgttttctattcccaggtccgtc
tttcgggaacgagtaaccagtcttcgtcttcatcatcacgtgtcaattcccggacactctcagtctctcgaccatttcgcaaccagccgacaagtgccca
agtttctacggccaggcacttccccattgtcaggcgttgacatggtctccactacttccgagacggcatttgctaccaaccccgtttggcacgacccaac
cgacgtgcaagtccgcaagattatgatggccagacttcggagccacccagcattggcgcagcaccacccgatcctgcagaccgaagaagacaccggcacc
agtccgtccctattgcagcgactggaatggatgctgtaccattccgccggctccttaggcgaatatctgcatcaaccatcactagaacggc