Description :
Non Conding Region
Location :
Scaffold_1:58146- 58655
Sequence
509 bases(100 bases per row)
GTAGTAGCCACCACCACCGAGCCCCCTCGGCCGGCAAAGCTGCCAGGCAACATGGGCTCACACACCAGCGGCTCGCGCAGTGAATCGCTGCGTCTCGGCT
TGGACAGCTAGGTATGCCATTTCTCATCGGCCTCTGGGTAATATAAGCTACCCTGGCGTCAAGGTCGTGTGCTGATCATGGCTGTTGGCACCCAAGGACC
TGAGCTGGTTACTCACAACCAAGGTGTCAAGCGGCCCACTCTACCGTCGCCCACGTGGAAGCCGCGTCCACATCAAGGCGCAGCCACATCGTGCCACATC
ACGGCGATGCGATCTTTGCCGTCTGCAGCTCCGCAGCTGGCTCGGCGCGAACGAACTGCAAGGCCATTGGTTGAAACGCATGGCCTTTTTCTGATTGGTC
GTTCTAAAATAGCGCCACCAACCACATTTAATTGTCAATATTCAATGGTATCGCAATTTATCTATAGCGGTCGACGAAAGACGAATTAAAATACGTTTTA
TTGACCAAC