Description :
Non Conding Region
Location :
Scaffold_1:57981- 59393
Sequence
1412 bases(100 bases per row)
TCTTCCTCACCCGGATCATTGTTTCTTGGCGTGGATTGCTGAGATCTTGCACTATTGATTAAGAATTTCGTCTGTCGTTCTTGACGCTCAGTGGCTTCGA
GTCGCTTAACCTCCCGAGCAGCTCGAATGTGCAAATTTTCCTCCAATTCGCATTCGACTTCTAGCTGAGCTAGACGCACTTGCTTATAATATTCGGCTTC
GAGTGCTCTTCGTCGTGTTTTAGATACAAACCCCTCTCGGTGGTCGTATTTCGCTAGCGGTACGACACGGACTTGGCCTGTAGCACTCTGACTGGGGTTC
ATTCTGGGAATACTCAAGTTCTCTCTGTTGTCTGGACTCTCTTGCTCTTGTAGGTTCAATGGTTCCAGCTTGTTTTTCTTCACTAGAGTACCCGTATAAA
CGTCTGTGGTCAAAGGCATAGCTGAAACTTTTAGTTTGCCAGCAATTGCAGTGGGAGATGATGCCGCAGTGGTCTCTAGTTTCGCTCGAAGGCGATCGAT
CTCTGTATGACATTCTTCAATCTCAGTCTCGAGCTCCTGAAAGCGAAGGAATTTGCTACATACGCGTGAGTGAGCAACACACCGAGTGCATGGTGGGAAT
TCGTGTCTTACCTGCTATACTTTAGGCGGTCAAGCTCTCTCCTTCGCTCTTCTGCTAGTGCTTCAGAAGTCGCAGCCTATCTAACCAAAGGGGAAAAAGG
GGGTCACTACCAATATTTTTGATTGCAGTCTATTCGTTCCGAACAGCGTTGTCATTACCCTCTGCATACACTCCGACACGAGACGATCAACAAGCTCCTG
CTTGCGTGTTTTGGTGGTCTTAGCGTCTTGTGGAGATCGTAAAATAGCAAACGCAGCTTGCAGCTACAACACAGTAAGCATTGCGTTAGGCTCCCGTGTC
GACTCTGTAAAACGTTAACGTCGTACATCTTTATCTTTCTTTCGCAGTGTTTCCTGCAACCTTCGAGATGCAGTTTTCAGCTGTAGAATCAATGCATCCT
ACACGTACAAGGACATGTTAGTTGCCTTGCAGGAACCAACCATTCATTCTTCTATTACACCTTCTCTGTGAGTTGTCGTTTCACTAATACAAGCTCCTGT
TTGGTATTTTCCCACTCTCTCCAGCCATCGTCCAGCTACAGCAACGTACGTAACAGGTAAATCTAACCATTCTCCGAAGCAAATTTGCATATCATCTGCa
cctcaagctgctggtacgGCGTCACTTGCGGTTGACTAGCGCTGTTGCCACGTCGACTCATTAGACGCCTCGCCATTGTAGAGTGACGCACGTTCAAAAT
AATCGTTTCGCGTCCCAAAATGATGGAAATCCGACCGGAAACGTCGCGATCTCATTGATACTAGCGGCCACTGGGCGAACGACTATGGGGGAGGCACCGA
GTTGGCAGCACA