Description :
Non Conding Region
Location :
scaffold_1:57964- 58302
Sequence
338 bases(100 bases per row)
GTTGGATTTGACCATTGTAAAACACTCCAAAAGAGCCAAGTTTTTAAAAGACACCTTCACTCTTTGAACAAAGGACGATTTTGACTTGACTGGGTAGCAC
AATCATTATGCCAATGACCACTCATCACTGACAGCAACACCTTCCTGCCCGTCTCAAGACGATCTATCAGGAAACACCAACTGGTCAAAAGTCTCCTTTG
TCACAGAAAAGAAAGAAGGGCAAAGGATCCGAAGACACCATTACACGATTGGCGAAGTTGCATGACCTTCGTTTTTCATTCATCCACTTCTCTCGTGCGT
CAAACTCCGCAGCTTAAGCTGAAGCAATACGCGATTCA