Description :
Non Conding Region
Location :
Scaffold_1:57520- 59029
Sequence
1509 bases(100 bases per row)
CGCAAATCGCGGAAAATCGCCAAGTGCCACGACCGTGAGTCGAGACCGTGTTTGGAATCTAAACTGGTGCACTCGCGCCGGTCACATCAACTGGTCACGC
CAGGACGCGCAGGAAGACGAATCTTGCGTGAATAGGTCGCCGCGGAGCAGCTAGCTACTCGACTTGCTGCTGCGTGCAGCGCCAATCTGCCGGGATACTG
TTGTCGTCTCCGCTTCGCACCAGCGTGGAGAAGATATATTCAGATATCCAGTGTATCCATAGTATAAAGACGATATAGCTATACCCATCGTGCCATACAG
GACCGCTGCGGTTCGTTGTTGGATTGAGGATACCAAGGTACAAGAAGCCAGCGAGCCAAGGCGTCATGGGCAAAATGATATTCCGACTCACGAGATTGCA
CACGATTTTTGACCAATCAAAATCCAAAAAGATCGTTGGAGCCAATCCGAGAACGACTCGTATGATCCTGATTCTCCCAAACGCAGGTCGACAAAAGGAA
GACAAATAGGACAGCATTGATTCATCGGATGCGAATGACCGCTAGTATATAGCCATATCCGATGACTTATGTCGTTGCAATTTCCACGCTGGCATTTTTC
CAAAAAATATTTCTTTTTGGAAAGCCAAACGGGCCGTCTTTCGAAGCAGGTCGGAACATTCGCGATGCTTGAAATTTATTCGCTGAGGACGGGTTGCGCG
TAATATTTTCAGACGACTCTCGATCGTACGTACAGCTTTCTCGTTGTGCGCGTCGTATGTACAGCCATAGCATTGAACGCATGCAACAGGAACTCCTCGC
TTGCCACCTCGAGATGCAGCCATCGAGTAGGAGGCCGCCCCTCGAAATTTCAGCAGCTTTCAGGACGAACCCAATGTGAGAGGTCTGTCGCTCGCGACCA
AAAAAGTGAGTTCGCTGACGACTGCGTCGACAACTGCTGTTGACGACTGTGCTACCACTCTTCGGCGCTATTCTCCAGCGCAGTTCTGCAGCTTGCCAGC
TCACACCATGGACCAGAGTCTAGCATTCGAGTGATGTCTAGAGCTTCACACTGGTCCTTGGAAGCTGCTGTTCCTTGGCGCGCCGACTCTTGACCAGACC
AGGTCAACGTGTAGTCAGATCGTGTGCACCCAGGTGCCATCTGTCAAGTTGAAGTTTGCGCATGGTCCATCAAGGTTTGGTCCGGATCTTTGCTCCTTTT
ATGACCTCATACAAAACGACAGTACAAGCCGTGGGCCATGCACACTGGAGGCAAGACGCAGCCGGAGTCGCCCAGATGGCGGCCAAAGAAGAACAGCAAA
AGGAGCAGCTGGCGATGCATTTCCGTCGCGGAAATCTCGCCGCTGCTGGCCCCAGACCCACGACCGCCGCCGTCGCGCGCTCATAGCGTCTCTGTGGCGC
CGTCTCTCGGTCTCTCAGCATCGCAAGTGGCACAAGGGCCGTCCTTACGTAGTACGAGCGCGCCTGTCCGAGGTTGCCGTATGCAAAGCCACTGTAGGAC
AGAGCCTAT