Description :
Non Conding Region
Location :
scaffold_1:57512- 57629
Sequence
117 bases(100 bases per row)
GCGTAGCTTCCTCAATGAGCAGTCACTGCTCAGCAGTGACTTTTTTTCAAAAAAATCCATGCAGGTAGTGATCGTGTGATTGGTCAGAACAAATATATTT
ACGGCCAATCAGAGTGA