Description :
Non Conding Region
Location :
Scaffold_1:57482- 64690
Sequence
7208 bases(100 bases per row)
TGACCAAAGGCGGATTGTTTTCCTTGGAGATAGACGTACCAAGTCATATAACGTTGAGTTGGAATCGTTCATGGACCGTTTCAAGGAAGCTTGGTACCCC
AACATGCTGTTGATCGCGGGATTGCAAAGCAGGTGGCAGGCGACAGTCCTCATTCCAAGACTATCTTATCGACTAACAATTTCCTGCACTACTAGGTCTA
GGAATTGAATGCTCCTTGTACTTCGATAGTCCAGAAAATATCCTACTAAACCGGTAGTACTGGTACACTTCGTGTGTTCTGTGGCTGCTGCTTCCAAGCG
ACTGCTGCTTCCAAGCGACTTTTTTTTAGAAATGCAAATGGAGTATGTCAGTGGTTCATCTGCGTGAGTTGATTTCTGCAAAGGCCTTACTTGGATCATA
CAAAAGACGTGTGGATGAGCTGACTGTGAATCGAAATCAAGGTGCGATGCGATGATTGGCTTATGTAATTCGTCCGTTACGAAATCAACCAATAACAACA
CACTCAACGACGTGGATAATTCAAATGCGTGCAAATCCCTCCACAGTTGGGGTTCTAACGTTAAGATACAAATTCTAGGTTCATGATTGAGTAGCGCTGT
ATCCGTTACACGTCCGACCAATCCAAACAATCGCAATTAACTATTGACCTTTACGATCAAGTACACATTACGTCAGCTGTTGCTAGGTTACAACGCAAAG
GAACTACTACGTAGTATTAATATGTAGTAATACTAAATCTATTGACCAAGGCAAGGCCATCCAATGCACGGGCTTTCTCAAAACGACGTTGCATGTATTC
GCCCTTCGATTCCGTGGCAGCCATCTTGCCGGCATAATAAACACGTTGACATGTTTCAAACGCATGAACTGTGCATCACATATGGTAAGTTGGATGGGGG
AAGTGTGCGGCCAACTCGACGGGTTGAGGACATTGCCCCAGAAATCTGGCTTCTTGTCGTCCGTCTCGTGGGCAGCCGCCGTGTACGAGGACTCCTAGAC
AAAATAAAATAAAATCAATAATAATAATAATATTGCTCCGGCCGCGGAACCGCTGGCCCACCTGGTCGGACGGGGTGACTCTTTCTCGGCCAATATGGGC
AGCAAGAGCGCCAGTCGTTGATGTCGCCAGTGACGCACGTCCGCGGGAAAAAGGGCACAGACTTGTACTGTAGCCAACGACGGTAGACCTGTCGGCGGTG
CACATAGTTGTTAAAATCCACTCTCTGGAAAAATGGATATTAGGTTTAACAGTTTATATATAAAAACCAGTTTTTATAGTTTATATATTTCAAGATTAAA
CTCTTACTCAGAGTTTGTAAACTCGTCGCCGAGATTGTAGTTGTCTTGATGTAATGTACAGTACCGCCGCACCTTCGGCGACGAATGCGTCGTCCAAAGA
AGCCAACACCCCCTCCACCCGTTGCAGCCAATTCGTCCTCTAGCGAACGCCATGCAGTTGCGTTGGGCTGTCATGTCGCTGCTTTTGCGAACCTCATACA
GTGGTTGCCGGTAAAACCCGGCCAGTGCAACTTTTGCCCATGACTTGAAAATACTATGTTCAGTGGTATGGCGCACAATCAAAATATAATGAAAATCACT
TCGTGCAACTCCGTGAAGACGACATGTATTGGCTAAAACTAAAGTCAGTGAGTCCGGATAATGCGCGTCGCACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTAG
CGTGATGATGAACTACAGTATGTATGCACTGCCATTTCGTTTGAGGATCGTAAAGTTTATCATTTCCCGCAGCCTCCTGTAAAGAACTTACTGTTAATTG
CAGCGAAGCATGTAGACATCCTGGCTCATGTCGGCTTCAATGACAACTTTACTTAACCTTTAATCCACTTATTTTTGAACTTTAGGTTTTTAGTTTAAAC
CAGGCATTTAATCCAATACTTTAATCTTAACGTAACAACTATGGCGGTGCACCAAGGTCGAATGGGGAATGTCGTGAAAAGGTCCTGCTCACATTCGCCA
CGACGGCACAAGCCCATCCCTGTCGTCGACGACGACTTGTGTGCGGGCAAGGGCATGGTCATCTTGGTCGTAGTCGTAACTATGTTCACCAAGCACGGCA
GTGGCGACGACTTCCGAGCTATCGAGAGCATTGGGGGCAGTGATCGATGCCTAGACAGAAAATCTGAATACTCGTCACCAATCAAAGAACGCCGCTCGGA
CGACAACTTACGACCACGAGGCTAGTGATAACGCTCGCAACGGCGTGGACGCCATGGGTGCTGATTTCAACAGCGTCAAAGGCGGGTTGCTCATCTGCCA
ACTCTTGGAGATGGTATTTTCAAGAGTCCGGGGACGACACTTGCTCAAGTGCGCGGAGAAGTCGATGCATCTACCGTGGATAATAGACGTGAGACGTGAC
GGTTGAATCGTGAGCAGAGAGAGGTCGTGCCTTGGTTTCGAGGGAGGTGTTCTCAGGACGTCATTGTTACGGACCATCTGAAATAACGCGCTAAATATTA
TTGCGACATATTTGAAGTACTCGGAGTACGACGAAGTTAGTACTACTACTACTATTGTGCTTTTCATGTAGTTTGCCCGTTGTTTAACTGCGTTAAACAA
CCAGACGTTTAAAATAATATAAGCCCGATTGAATATAAAACAACGCTAAACACAAGTTCTGCATTTCAGCACAATAAAACAACGCTTACTTTATTTCAAC
TGCTAACTAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTAGTC
GTAGTGCGCCATTGCCTTCCACGTACAGTGCTAAGGTTAGAGCAGATCAAGAGTTGAAGGTATGACATAGCTTTGAATCATTGGACAGAGCGACGACTAC
ATGTACTGTAGCCTAACTATATCCCTAACGTTATATACATTACTCGGAGTAGATAATGATAGTACTGTAGTGATCACGGATGGGAGGTCATGTATGTGGC
CATAGCTCCTTCAGTTTCATTGCGTCAAGCACCTTGATATGTTGACGTAAAGCAAGTTGTTTGCCAGAATGAAAACGGCAAACAACTTGTTTTACGAAAG
TGCCAGTAAAACCACCTTCAACCAACCAATCATCGCATTAGATGAAGTAACTTTAAACAACGCACCCAACCGTTATTCAAGTTACTTTAGACATTATTTA
AGCCTGAGAGATTTTTAAACAATGAATTTAACCCTGGAATTGCCAAAAAAGGTGCAAAGCACAATACTACTAGTATTATTAATAATAGTACCAGGTATTA
ATATATTGATATCACTATCGAGGCACTTTTCTGCAAGAGCCAATCAAATCCACTCAAATTGAATATGGTAGCATCGATTCGATTCGACGGGAGTCTGGAA
ATTTGTACAAGTACTTTTAGTGTTATTATACAGTGATTTTGCACCCAGAATCCACATGATTTTCCACAAATTTGGGGAGCCGACCAAACCGATCCACAAT
CGATCTGATTAGTTGAATTTCAGTGAGAAGGTTTTGATTGGCTAATAATTTGAACTCATATGAACTTCGTATAAATCTTGCTCAATGCTCATTGGTCAAA
ATTGGAAG