Description :
Non Conding Region
Location :
Scaffold_1:57463- 59474
Sequence
2011 bases(100 bases per row)
ATTTATATGGAGAGGGGAGCGAGGACAGTGTGTGTGCGCGCGTGCAATTATGCAGTGCGCTTGAGCCTGCGGTTCTGTCTGGTCTCTCGGGCGCGCGCTA
CGAGTTGAAATGCGCTCTTGACGTTGCATGTGGGCTGTTTCGTCGCCTGAGTTGTTGTTTATTGCGCGGGAATATCGATACGGACTGTGAGCAATTGTGA
CCTCCATGCGATAAGGACGCCTGTCTGGTACTTAATGTTTGCCAGCGCACTTGAGACACTTTAATGAGACAACTCGCGCGTCCTTGAAAGCAGGGACCAT
ATGGCTACATGGGGGGAACAAGTGCGGAGGCTTTTATTTGGAGCCTCTAGATTTTCCACCCAGGTTCAATTGGCGGAGAGAGAGCGATTTGCTCAGCAAA
ATCCACCGAATGCAATTCGGACTTCTATTTGTTAGTGTCGCCAGACTCTAGACTTGAGAATTGTATGCTTCGACCGGTAATACCGATAGACGACTTTTCA
ACAACTGTGCACTCTGGCAAAGCATTTTTAGAAGTCCGTACTGTGGTGACCTGTCCAGCGAAATCCATTGATTACATTCACTATGCAATCACGGGTGTAA
TGAGGACAAGTGCAGGTAGACGCGACGGTGACTATTAGCCTGTCCGAGTGGTGTAGCTCCAATTAGACTAATTAGAGAACTTTCGGAGTTTAGTTTCGTT
TTTAGATAGTACACGTTTATGCAAAATCAATGTGAAACTAAAAGTCAGCAAAACAACAGTTTCGAAGACTTGTGTGGAGTTTCAGCACAGATACAACCTC
GTACCTATCTCATTATTGAAAGTATATTTGCGACTCTTTGCTTGCTCGGGATAATCTCACACTTCCTTGTGCACTGCGCGATCATGGCTGATAGATAACA
GCGACGCTATCGAAGCAACCAGCGATCCAAGAGCTGCCTCTCTTCACTTACCTTTTCAACCAGCATCATCCCAAGTGCATGCAGAGCTGTCTTCCGAGCC
TAGAAGAGCGTGGAAAAAGTTTGCTCTCGTTGACAACCTCATCCTATTGAAAGATGCCAGCGCATATCGACCCTGGAGAGCTCCTGTTGGTACGTCTAAC
GGCATCATGAAGGTGTTTGACGACATAGCGAAGCAGTGCTGCGCAAACCCTGAGTGGGAATGGGTTGGTGCACACCATTGCACACGGCTATGAGGAGGAA
TAGAAGCCACGCACCACTTGACCCAATCGTCTGCCGTCATGACAAACGCTACCTTCGCATCACATCTCACATGCAATTTGAATGCATTAAGGTTAAGTAC
GTGTATTCAGTAGCTGCGAACTTGCGTGCCTATCAACAAGCACGGTGTTGATGCGCTAGCATCATCAAGCGTAGCGATTTCCCCATCACCGTTTCCATTA
ATAACCTCTTAAACCTAAACTTTATATACTTTTGCATCAACCACCGTACTTCCACTTTGCTGCTTTCTGCACATTTTTAGCCACTTCAGTATTTTGTATA
ACTTGATACCCCGTTGAATCCGCCCAAACTATAAAAATGTGGCGGGATTCTACGTCTTCCCATTACGATGGTGGGCGATGAAGCATTGCGCCACCTGGCT
TCCGCATCATAATCTGCGGCTTTCAAGCGACCGTAAACGCGCGCGTGCCTCTCTGTTCTCTCGCTCGCTCGCGTATCTATCGCTGTCTGTGATCACCACC
CGCGCCATTCATCGAAATCGCGTGGTGGTCAGGAACGCATGTCGGACGGTGTCATGTCGGCCGTGACGTGGGTCGCCGTGGGGCTCGGCGTGGTTGTGGT
CGTCGGGATCGTACTCATCGCGTACTGCTGCTGGTCGCACGGAGATGACGACGAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAACAACGACAAGCACAA
GAACTGCCTCA