Description :
Non Conding Region
Location :
Scaffold_1:57443- 57774
Sequence
331 bases(100 bases per row)
ACGAGTGGAGCTTTTTCTATGGCCTTTACTATGAATGGGGAGGAATTGGCTCTGAAGATGACATGAGATCTAAGCAAtggatgaagtggaccaCACCATT
TTAGGACTTTTTGACCAATCGGTGAGACTGGCCTTATACAGGGCGACTACGACCTGCAGGATATGAAATAGGATGGCTACAGTCAAATACCCGGAACAGC
ACTATACTGTAACGTTGTTAGAGCTCAAATACTTGACAGACTGCACAGGACACACTAAAGCATGAGTAATGTATGCAAACAGAGCCGTTCGTATTTTATC
CTGGCTATCTGACGTGGACAAGGTTGAGCAT