Description :
Non Conding Region
Location :
Scaffold_1:57342- 58290
Sequence
948 bases(100 bases per row)
GTGCGCGTGGGGAAGTGGCGAACACAACAAGTGGGCGGGGTGGGTGAGCGAGCGCGCCGGATCAAGATCTCGAGCCAAGACGATGGCTGGTGAGGGACAA
TGTTGGGCGAGGGCGGAACGCAAAATGGTGAATGCTGGGACAAGGCCGTCGTTCCGTTGGGGGAGGGCCGCGCATTCGAAAGAAGAAGGCGGCGGTGCCT
GAGACTTGAGGGGGGAGTTGCGTCTGAAGGGGCACGGGCACACAACGATGTGGGGCTGCGGGCGACAACCGCGGCAGCAGCAGAGCAGATGGCTGACGCA
CTGGCCTCTTTCCATAGATCTCAGCCGGCGTTCACGACCAAGTCGCCATTGGCGGGGCTCTGCTCGCCGTCTGCGCCGTTTCGAGGCCGCGATCTTTTCC
TGGAAGGAATGCAGCAGCAGCTTCAACAGCCGACGCGCAAAAATTGGACGCCGTCCGCCAGCACCGGCCAATTCTTCTTGCGAAATCCAACGGAAGCGCA
CGCGAACGGCAGCGGAAGCTCCAAGCCCGGAAACGGACACGAGCTGAAAACGGCAAGCGCAACGGCCCGAGAAGAGAAGAATGCCGACCCAACGGAAACG
GACGAGTGCAATCGGGCCCGGTTGCGAGCGCTGCCTGTCGCGCTCGGCATCTGAGATCCACTGCAAGGATCATGCTCGCGGCATAGATGTGCTCGGCGAC
CTGGTGGTCTGCAAAGCTTTTTGCCAGGATAGATGCTTCAAAGAATGGAGATGTGAGTCACAGTGCAAAATACAAACTCATTTGACTCACATTTAGTCAG
GCGTGAGCGATCGAGATGCGAGCCTGGCAAGAGCGCGGGCGGGAGTCACCTCGATCGATGGAATGGGTGGATGCTGCTTGAATCAGTTGCACTGAGCGAT
CTTGAGCGTCGGGCGTGCACGGCAGATGAGATGAAAAGGCGCGGTGGT