Description :
Non Conding Region
Location :
Scaffold_1:57283- 57528
Sequence
245 bases(100 bases per row)
CTTGCTGCGTGGGCCCACGTCGTCCCGCTATCTCTCAAGTCCGTTGCAATCGGAGTGTGGGTTTCCGCACTGGAAGCGAACGAAATGCTGCTGCTTAACT
GCTGCCAATCCCCACATTTAGACTTGCCCACTCGCACAACGAGAATAGTGCTGAATGACCACCCAGAAGTGAACAAAAAAGAATACATGTTTAAGTTAGT
CGCTTGTGCTTGAGTAGGATGATCTGCTGGTTTCCCCACGAGTAT