Description :
Non Conding Region
Location :
Scaffold_1:57078- 57719
Sequence
641 bases(100 bases per row)
GCAACGTAGCTCCTCGATCAAAAAGGATGTGGGTTGTGTGACGGTACACAGATCGTACCCCAAATCAGCAAGGGTTGCGATTATCGGTAACCAGGTAACA
GTACCCCGCTTGAACCCTCACACTCAAAGCTGTGGACCACGGCCTGTCGCGCATGCAGGAGCTGCTGAGCAGCTACTCCGGGCTGCAGACCAGGAGAGCA
AGCAGGAACAGCTGCGCAACATCGACTCGCCTGTGCAAGTGTATACATCACCGAACCATTGGTGCTACAAGCCGTAGACCAGAGGATACCAAAAATCGGA
CACATCAGGCTGCCAAACATGCCCTCCTTGAGCACCTCGTCGCGCCACGAGCAGCGGCGGCACCGGCGTCTCGGCGGATGGCTTGATCACGAACGGACGC
TGGGTGCAAATCACGGTCCAGCGGCGGTGGGCCACGTAAAAGGACACTTTGGAACTTTGACCGCGTGCGCACGATGGAGGCCTCGCGAAAGCGCGCACGC
TCGCCGCCGGTCGGGCTCGGCGCTGCGGCATGATCGAGGGGGACCTCGCGGATTGGGCGGCGAGGGAGAGGCAGCAGCGGCAAGCGGGGGTGGCGGAACA
CAGGCACGACCAAGGCGTGTCGATCCCGATCCCTAAGCGGC