Description :
Non Conding Region
Location :
Scaffold_1:56996- 57265
Sequence
269 bases(100 bases per row)
TATGTCACGGATAGCATGATCACTGGGGTTTTGGTAGGCGCCTTGCTTGCTTATATACAGCTTTGCCATGTATTTTGTGCTGGTGAGTTTAGAATAATAG
ATAAAATACATCGCCATCGGTAACGTACTGCAGCGATAGTGCTGGGTTATGGCTGTTTTCGTGGTTTGTACGCCATGAGATTAGATGGGGAAAGATGAAA
GCGGATTGATAATAAAATACATAGTCATCAGTCACGTACTGAGGCGATTGTGCTGGATCATGTGGCTTC