Description :
Non Conding Region
Location :
Scaffold_1:56938- 57125
Sequence
187 bases(100 bases per row)
CGGACGACCAACACACTGAGGACTTGATGCAGATGTCATTGTGGTATTATTGATGTGTTAACAACAGCGGAGAACGATGCGAACGACACACGGCAGCCAG
GCGATTTTACTGGAGTTGGCCCCGCTCCCTCTGATGCCCGCTGCTGTGCCCGTCATCGTTTATAGCGCGGTAGTACGAATGTCAGCA