Description :
Non Conding Region
Location :
Scaffold_1:56791- 57493
Sequence
702 bases(100 bases per row)
GTGTTAGTGGTGGATTCAACTGTGAGAGCGGCGTTTCCAGGACTCCCGAGACATATTAGCTCGGCGGCAGGATAGACACATGACGCCGAGGTACGCGTGA
CGCTAATAACAATTTGTCCGACTACAACTGTAGGGCAGATATACTGTATACTCGTTCTGCTTGTTAGCGTGACGCCTAACGGATCCGGCCTATTCGCCAC
AGTGGTACTTATGATGTTTAAGAATCAACAAAATTCACGCGGTCTGAACATAAAGGAGTATGTACTGACTTACTACAAGCTTAGCTCAAGAATACGGTGG
AGGTATTTCCGCAACGTGTCACTTGTCGCAGTAGGTCTCGCTGTACACTCATATAAATCAATATGTTTGCAGAAGTAGCGCGCAAATCTTGAGAGCTTGT
TGTACTTCCTGTGCGAGGTACATTAAAATATACAGCCGGGACTAGCCCGGGGACGCCTGTAGTGACAGATTGTGCGCTGCATTTGAGACACAAGTGAGGC
GTGGCAATCAACTCTTCTTCACCAAGTTCGATGCTTGAACATGTCATTTAACCTGATTTCCACGAACTATTATGGCTGCCCCATGGATGATCTTCCGAAC
GAGAGTAATCACGCACTATCCTGCGCTGAGACTACATTCCTACCTAAGTTGCTCGTCATTCCAGAATTTTCCACCTCCAGCACAAGCGCGACTCCGACGC
CA