Description :
Non Conding Region
Location :
Scaffold_1:56534- 56556
Sequence
22 bases(100 bases per row)
TGGTGGCAATGCTATTGAAGTC