Description :
Non Conding Region
Location :
Scaffold_1:56507- 57778
Sequence
1271 bases(100 bases per row)
TTGTTGGCGCTTTCTTGGTGTTGGGAATTTGGACCGAGCCAACTTGTTGGAAAACCAACATCCGTCCGATTTGATACAAAACCTCAAAACCTTGCAGGGA
AAGAAACGAGAGAAACGCGATCTGATTGGCTAGAATGCAAGTTCAAGTGCAAGCGCCAGTGTTGTTCGCCCTGGAGAAGACCAATACTTGGAAGAAACGA
GCCAACGTGTTGATGATACGTTGGCAAAGCCAACAACCAACAACCAACAACCATCGGAAGCGCCGTGCCGTCTTTCTCCTCAAAAAAAGGGAGTCGTTGG
ATTTCCAACTCGTCTCGGTGGCGAATTATTGGCCAATCTGCCGCGAGGGAAACGTGTGACAGATGGCATGTTGCCTTTTTCACCACGAAACGACCAACAT
TCAGACCAGGGCTGCGTCAAGTGGGTACACTCGCCGACAAGACCTTCGGTTGCATTTGATTAAGCCACCACCCCACACCTCCTTCCTGCGACAGACATCT
AATAACTGTGTGCTATTCTCGCCTCATCTGCGCAGGCCTCCTCCCTAAAATAAGATGCTTCAGCACATCCCTGCGTTTTGGGCTGGTTGGCTGTTGGCAC
CATGGCTAGCTGGGTTCCTGGGCTCACCTCCATCACGAAATTCCCTCGGTCGGTAATGACTCCACCGCCGACGACCGATGTGGTCGCTCGTCTCCACGCG
TTCTATCTGGAGAAGGCGGTGAGGGGCGAGAACCAGCTCCCGGCACTTCAGGAGCCCCCTCCTCAATCCGTTGTCGACACACTCGTGAGACTCGACATCG
ACTTTGATCGCTTGCCAGTAGCGCTTCAGCATGCGCTCATGTGGGAAGCAGGCTACGCAACGATTGCAGATGGACGAGTCGTCGCCTTTCGTACGCACTG
CGGACTATCAACGGCAGATGCGCTTTCGCGCTCGACCGAGGCTCGCCCAATGTGTGCTGTCCAGTCTCCCGAAGAATCCGCAACTGATCTAGCGTGGCTG
ACGTTCTCAAATGAATCGCCACTGCCCACGGTGACCTATGCAACTTCGGGAGCATCCCGTTCGCTTGAGCTGGGGGCCTTAAGTCCTTGTACTACTGCAA
CCGTCCAGGACAACTACGATCAGTCGTTCTGCATACCAAGCCCAGGATCAACTCTACATTCGTGGATCTCTCTCTACGTGGCAACAACGGCAACTCCCGC
CGCTAAGTCTCGACGAACCACCTCAGCCAGCGATCGCGCGACCGGAACGCAACCCGCCTTGACCGCCAGCA