Description :
Non Conding Region
Location :
Scaffold_1:5633- 26578
Sequence
20945 bases(100 bases per row)
ACTTGCTCTCGACTGAGCAAATTCGGAAATGACAAAAGTCAAAAAGGCTCGAGTCGAAACTGACGACGTTTTGGCTCGAGGTTTATCGGTCTGTTTTCTT
TTGCATCGATCCCAGCGGAGACTTTTGGCAAACGAGTTGCCACCAACCGCCACTGGGACTCAGTGACGGACGGACGTTAACCACTTGGACATTATATGTT
ACATACAAACATTTAGTGACTTATTCTTTTGTGTATTTGTGTGTGTATTTTTTTCAGATCGCTCGTTGACGCTCAGACGAAAAACAATCACCATCATGGC
GACTGTCGCAGACTCTTTCTTGGAAGACTTGGACGAGCTCAGTGGAGGCGGCAGCAGTGACAGCGCTTCGGACCAGGAGATTGAGGCAGAGAGTCAGGGT
CATGACGAGGACGAGCTCATCGACGTGGCGGTTTCCCACTCAGACAGCAGCGAACGCGACCGTGTGGACGCAATAGAGCAGACCAAGCCAGAAGAGAAGA
CTGAAGACCTCTCCAAGTCGCTGCAGTCATGTGGCAAGAGCCGCAGTGTGGCTGCTGTCGCGTCGCTCAAGCGCTCTCACAAGTACCTGGCCCACGTGCA
GCAGATCCAGCAGTACGTGGACCTGGACGACGTCGCAGCAGCTGCAAAGCTCCAGCGCCTGGAGGAAGGCAGTACCGAGTACGATCTCGTGGTCACGTCC
AATGATCTCATGGTGCGGATTGACGACGATATTGTGGCTGTGCACCGCTTCATTGCGGAGATTTACGCGGCCAAGTTCCCGGAGCTCGACTCGCTCGTGC
CGAATGCACTCGACTATGCGCGTGTTGTCAAAGCCGTTGGCAATGAGATAGACCTGACGCTTGTGGACGAACTGCCCAAGCTGCTCCCGAGCTCAGTGGT
GATTGGGATCTCCGTGACTGGCTCGGGAACGAGTGGCAAACCACTTGGTGTTGAAGAGCTCAAGATCTGTATGGAAGCTTGTGACGAACTGTTGTCGCTC
GAAAAGGACAAGAAGATGATTTTGCGCTTTGTCGAGAGTCGCATGAAGTATTTGGCACCGAACGTGTCACAGTTAGTAGGCACTCGGATTGCAGCGCAGC
TCGTTGGACTGGCTGGCGGTGTGGCAGAGCTTGCGCGGATCCCGTCGTGCAATCTGCAAGTACTGGGGCAGGAAAAGAAGGTGCTAAGTGGGTTTTCGTC
GGCTGCGGCGCTGAAACATACAGGTGTCGTGTTTTTCACGGATCTCGTGCAGAACATGCCTCCGTCTTTGCGAATGAAGGCATGCCGAGCTGTTGCAGGC
AAGCTAGCGTTGATGGCGCGTGTTGATAGCCAACCACATCAGCATGACACGGAAGGCTTGGTGGGTGCGCGCTTTCGCACCGAGCTGGTCGAGAAGATGG
AAAAGTGGCAAGAACCACAAAAGGCGAAGACGAAAAAGGCATTGCCGATTCCAGACGAAAAGCCGAGCCGTAAGCGTGGTGGAAAGCGCTACCGTAAGAT
GAAAGAGCGGCTACAGATGACCGATGTACGGCGTGAAATCAACCGGCAGTCATTTGCTACGGCTGACGAAGAATATGGTGACAACGCCATGGGCATCACG
TCCGGTCGGCTCGGTCAGGAAGGATCGGGTAAGTTGCGTATCTTGCGCAAAGAGCAGAAGCAGTCCAGCAAGAAGTTGCGTGCGGCAAGCTATGCGGCAT
CTTCTGTCAGCAGGCCACCGCTGTCTGGGCTGGCATCGAGCCTTGCTTTCACACCGGTGCAAGGCATTGAGCTCATGAATCCCGAAGCTGCGAAGGCTTG
TGTTGCCGAAGCTAATAAGAAATACTTCTCTGCTGCTAGTGGATTTTTCAGCGTTGTCAAGAAACCATGAAACAAATGCATTGGAGGTACATATAAGGAC
GTTGGGCACTTTTTTATTTTCCGATTAACTGGGACATTGGTTTTATTTTCGTGATTAAATGGGGCATTTTTTATATCCCTATCCCATTTTTATTATATGC
GTAATATAAAAATGTATTTAGAATTTTAATTGATATATTGATAGGATTGTCTGACATACGTGCAAAATGGCTGAATCTTTCGTGCGTGGTGACACCATTG
GATGAGCATAGGTTCGAGTCTAGCGTCGTCAAGCGGATGTAAGGTAAGCGTCCAGTATAACGTGATTTCTTACGAGTCAACGTCCGCGCCGAGTTACATC
CTATTCGTCGTGAATGTTAACAATTCGATTACATATACAAAAATGTTTGTACAGAACACGAAAGTATACAATATGTAAAACAACCTATGTGACGGTTTCT
GTAATAATGGCTTTCGAGACTTTAATCATGGGACAGCGGGCGTTAATTGGGTAGCGACCGAGAGAATGACATTACTCTAGCATGACATCCCTATCTACTC
TAGAATTACATCTCCACCCACTAGTCATCTTTATCATTAAACTAACCCATCGTATCCTGAGATGTATCACGCAAAGATGGCAGGATCCTAATCTGATAGA
AGCAAATATTAGTAAAAATTCAGAAGTAACATGTATGTTGTGAAAGCGAGCTAACGACCTCTCATAAATATGCAACTTCGGTATTTACCTGTGAATAAGC
GGTGCCTTACGATTATATAATACACTTGGTCTCCTTTTCGATCGACAAGCGAAATTAATATTTAATTGCTAAACCACCGGGACCTTTACACGCTTCCAAT
AAAAAAAGGGAGCTGCAACGGGGCAACAGTACTCGCTACTAATCCTCCAACACCTCCATACATCACTGCGGGCCCGAAGGGTGAAGCTGTTAGTGACTGT
GCGCAAAGTGAATGCCAAACTTTCAAATCCTACTTTCTGTCTGTCTGTCCGTCTGTTTGTCCAAAAGTAAAGCTAGGTGTACCATACACGTCGCACTGCG
TGCGATATTGCCTGTCCCATCCTTATAGGTAGGTATACATCATAGGTTACTCTTTATGTGGGTCACTATTTACGACCGCGTATAGTGTTTATCACCCACA
CGCACCAAGGCCCGCACGGGATTGGCTTGAAAGCAATAAAGGACAAACACAAGGCAATTAAGCAAATGCAGAAGTCTCGCACCTCGAGCAAACGGAAAAT
GCAGGCTCCAACGAGGCCTTTTTGGACCGGTTGCCGGCGGCGCCTGTGCCGTGTTGGTGTCGTTCTTCTCTATGGTTGGGCTCATAACCTGTAGAAAAGT
AAGCGTAAAGTAAAATAAATGACGTGTACATTAAGCTTTTCAGACGCGATTGGCCCCCAGCCGGGGGCCTTGTCATTGGCTCTGTCAATTTACAAGTGAG
AACTTACAAGAGCTCTAACTATCTAAGATCTATAAGTTTCACAAAGAATCGAGATTACCTTAGAACAACTTATGTATTTTTTGAAGCTCTGGCGTCGATA
CCAAGTGCAACATGCACTTCCCAACAGTTGGCCTCTGATTTAGGCCCCATCGTCGCACGCATCGAGAATCTACAGTTAATTTCAGATAATCTATCAATCA
TTGTCCCTTTTACATCAATAATGGTTCTTCTCATACGGAAATTATGAGGGTCTGGATGTAGATATGCGAGCTGTTAGCGTTACGCAGAACATCAGTGGCT
TGAGAATAGTCGTTTCTTTCAACCCACGTGGATAGCTTTGAAGATTCTGAAGCCATATCGGGTAAGATTAAGCTGCAGGCCTGTTACAGCACGGAAAGAA
TGAAGCTATATGGTATGTCGGATGTCGACGTTTCGTGTCTCGCGTGGCAACGAGTAAATGCCCTCTGTAAGCGCCACACCACACCGCACCGACCCATTCA
CATCATTTACTCATTGTTCAAGTCACGATAGAGTAGTGCAGTGATCTACTAAGTGCTCACTTACCGCTGCCGAAGCCGTCGCCGACCGTGGCGCATTTTA
TCGTAATGCTTGGCCTCTGATTTGTAGTACACCTGCAGTACCAAGTATATCAGTGACATACGTCGTTAGTTCTAGCGGCAGGACGGATACACTGGTGTTC
GTTTGTGTTGATGACGTGAACGCAGAAACGTAGAACTGACGTTTGCAGTGTCGATGGAGGTGTGCAATCCTTATGGCTTGCTGCCAGCAATCTGTACGAC
ATGTTTCAGTTCAGCGGATTTCTGACAGCTGGATATCTGGTGCTGGACGTGTTTTCCGCGTTCCTGTATATCCTCCATAGTTACCAGCTTCTGTCTCTGC
TTTGGGGCATTGCTTTGGTTTTGGTCATGGGAACGGCAGCGTTTTTTTCCTGCAGTTTTGCTCTCCGCGCTTTACCGGATGAACAAAACGGTCGAACCGG
TGTGCTGTCTTTATCCGACGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTTGGCTACGGCACCA
TTTGAGACATCTTGAAGTTGCCGTAATTGCTTTCTTGTCATTGGGCTACTTTTTTTCGGACATTGTATGACGAAGTTACACGCGGCACCTCTAATGGCGT
TTACTTTCGCGATAAGTCAACGGCTTGGTCGTTTTTACAGTTGTTGTGTAATTATGCGTTCACTATGTGGATTCAGTACTCCATGGAGCTTATTCTGCGC
GACTTGCAGGATCAGAAACATTTTTTCAAGCTCAACATGTATCGTTATTTGGCGTGGTCGCTCGCTGGCTTCATCGTGTTTCTTGCCGCTCTTACGGTCG
TGGCCGTTTTCAGTCGACTTGACGTGTTAAGTGCGACGTCGAGTGGGAGTGGATGCAGCTTGTGGCCTGGCCTGTGCAGAACTTCATTGTGGCAGCTACT
ATGACTTTTATCTGGTCCCTGACTCAAAACAGCTCGCGGTTTTGCGTACTCTGTGCAGGTATGTGGAAAGAGCTGTTTTTTATTGATATTCTCTACTATT
TACAACTGATTAGTCGTGTAAAGCTGTACGTTAGTTATCGATGACGGATATGCCAGGTCTCGAGCTGACACGTAAGACACATGGCGCAATAGACAACGGC
AACAATTTTTCCTACGCGGAAGAAGTGTAGCTAATACCACAAGAATTTACGTGATGTTGATATCCCCACGTATCGCACTCGCTTCGGGGGCGGTTAACAC
AGTCGTTTGGACGCTCAAGAGGCTGTAAGGGACATTTGGTTGGTGGTGGTGGCTCATTCTCCATCGGAAATTGCTTTGAAATTGCGTACATTTGGATTAT
CAACTACGCTTGCATTTGTCACTATACTGATGTGGTTAAATAACGTAGCCTAACCACACATTTGATGCATAGGATAGCAAACTGATGAGATCACTTGATA
TGTAGGCTTGTACCGGCTTAATTAATGTGAAGGCGACATAAAAGCGCAAATATACGAACTTGATAACACAACACACATCTATTATTCTGCTTACCCTCTG
GTTATGCTTGAGTGCTACAACAAACCCGCCTTCCTGAACCGCCTGTTGTGGACAGCTTTAAGAGGTTGTCAGAGAACCATTGGAATAAATGTTAATGTGA
ATCGTAAAGGGAGTTTATTAAGTAGTGACGACATCTTAGTAAAAGTAACATGTACATTAATAACGACTATCTCCATACACATCAACAGTTCAATGTTTGA
TGCAGCATTGACAGCATCAAGTACAGGATCGAAATGCGTAATATCCTCGGTCTGTCGCAATGTTGGAGGTAATTCAGGCGATGTTTGTGCTGTGCTACTT
GAAGACATATCCTTGCGCTGGGCTCCGAATGTCACAGCGTCCACATCTTCGAGGTCATGTAGGATTAAAAAAAAAATTCATCCTCTACATGCTCAAAGTG
AGATATATTGCGGCGGGTAGAACATATTGGGCGCCCGCGTGTCCTCACCAGCACATGATCACGTATGGCAGAATCTGGAGCAGCGATAGCATGATCGTAT
AGCATCCTTTGCTGATGCCTTTCAGCATTAGCATATCTCTCACAAAGTATTCCAACACAGCATCGTAACAGATACTATCATATCTGACCGGCTCGGTGTC
AGCCCTTCGTGTTGAAGGTAGGACCACCCACCCAAATTCTGGCCAAAATCTTGTACTGTCACTGGCCATTGCATTATGATAATTCCATGACACAAAGATG
GACCATGTTATTTTTCATCAGATCTTGACAGGGTCCTCGGTCAAGTTTTTTAAGACATTGACGATGGGCTGCCAGTACACCTGAAACTATAATTTTGCCC
ATTATTCTCGCAAATGAAGTTCCTAGCTGCATCTCGACGATGGCGCGTTCCCTTGCTTTTTTATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCGACACAAGACGTTGTCACATGACCGTAATGTAGAACACTACGCAAGTGGCAGGTCACGAAAATTTTTGTGTAAACAAGCCAAGTATCCTCCAGGTA
CCGCAATACATGAGCTGGTGATTTAACTCTCATTGTAATCAGCTGGTGGTCGTACTCTGTCGTTGTTTGAGCTTGTATTAGGCCGTTCCATGCACGCTGT
AATTTATTAAACGCCTACGCGGTTTCAAATTGTCTTTGCATCTTGGCTGTGATGTTCTTGTTTATACGCCATCTAAAAAGCAGTGTCCTCGAAAAGGAAA
AAAGATTTACTAAGCACGTTCATTAATGCCATCTCACGATCAAAAACAAATGTTTCCGGTGTAGCAGTGTTAAACATTCCAAATACCTGCCTCAGGTTCT
GCATCGCTCAAAGGTTGTCGTCCTCTGCCCCCTTGAGAATGTAGAAATGAGCGAAAGTGTAGGTGTTTTTGGTCACAGTGAAGCCTACAATGTGTAATCG
CAGTAGTCTAAATCGATTGGTCTTGTAAGTGGCGTCAACATGAATATCTGACTTGCGATGAACCAGGCGGTGGTTCCCCTCTCAGAGAGTCACACGATAA
ATAGATGAATGAGCTGCTACTTAGCATCAAATCTCGCGTAGTACGGCGCATTGTTGTTTCTGTCGTTGTTTTCGTCCAGAATGTCAACAAAATGTGCAAA
CGGAGACCGCCCTCCTAGCAATCTGCGACGTTCATGTGCGCGAATGTTGTATATATCGCGTGCAATGGAACCCTCAAAACCAGATGATGAAGGAAGGCAA
CTATGCGACCAGTGCTGATGCCTGCACACAGACTTGCAATCACAAATTGTTCTTCCGTAAGCGCACGTCCACGTGGATGCACCTTGCTGTCTTCAAAGGA
ATCATAGGTATGCTTCTAATGGGTGACTGTAACCACTGATCTGGTTGTTCTTGACGTTGCTTTGGTATGATCGTGGCTAAGAAGGAGCATCCAGTGGAGC
GGCAGGATACCAAGCGCTGACGAAGAGGCGCTAACCTGAATCCGCCTCAGAATAAGGCCGATGGTCGTTGCATAAGCATGACAGATTTACTTTTTAAACC
TCACCGCCCTTGCGGTTGTCCACCCTTTGTTGCCTATTTATTGTATCAACATAGCCTTCCAGCAGTGTTAGATAGCCAATCGCGTGACCGGCTTCATTCA
CAGAACGAAGCCGGTCACGCGATTGACTATCTGACAGCAAATAGTCTCCAGTGATCTGGTTAGATTTTCCGTGTTACTTTTTAGGAGGGAGGCCAGAGGT
ACGATAATGTAGGTGATACTAAAATTAATGGACCTTATTTCTAAAACGTACAGCAATACAATTTTACAATTTAGAAACTTTAAAATCCGATTACTTGTTT
AACGTATGAGGTGAAGGCTCATTAGCGACAACTGAAGGCTTACCAGCGGCTCCCAAAGAATATTGAACGACCTTATCTATTTCAATTATTTGAAAAAAAT
AGAATAACGTCAAAATTATTTCAAAACATCTAAATATAAAAATGCGATGGACTTCAACAAAAATAATATTTTCCATCAAAATTCCTCACTGACTAGAGCT
AAAATGTCCTGTGTTCTAATGGACTATCAAAAAGTATTTTTTATTTAAAATGTCACGAATTCAATTACGTCGCTTGATTTAAAAATAAAAAATAGATTCC
GAAAATTTGTTACATTATAAAAATTGGCGAGACTCTATTAAACGCTATGTAGATGCATTTCTTTGTCAGGTAGACGTTGATTCAACTCAAGTTTTTTAAT
CTGGATTGCTTAAGCACGACCAATGATGATTTCGGTCAAAACTATATCATCATCCGCGATACCTATATTCGCTGAAACGCACTTGGAGACGTGTATGTTC
AAGCCAAAACAATATAGTAATTAAACTTAAGCCCGAGACATAATCTTAATCCAACGAGAACTTGCTTATTTGAAAAAGCATTTGATCTGCTCAGTCGATT
GTAGAGGAAGTGCGATCCGCTTGGTCGCACGGTGGGTTTTAATATTTTTGTTACCTAATGACGACACTATGAAGGTATGTGAGATGTATGATTGATACGC
TGAATGTGTACGCGAGTCTTCGTTTCTTAACAAAAATATACTCCCTTAAATATTAATTTGTAACTTATTCGTTCTTAAGTCATGATACTAGAGTAAAGTA
GTGACTTCTGTTATTAGAGTCAGCTTTCTAAATTTGGTATGAAGCTAATACAAGCAGATTCTGTTTTAATTTAACAATTTGACAATCGATAATATATTAC
ATTTCGAGTGTTTTCATCTTCCCTCAGTTTTCTGGTAAAATACACCCAGTTTGATATATGTAACGGGACACACCTTATTCAACTAACGGAATAAACCTTG
CACTGTTGACAGTGCAAGGGTGTGTGCGTCTGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCGATACGGAGTAAGAGTGTTCAGTGAAGGTAA
AAAGTAGAACTCTATTTAGTATAGTTAATCCTTTTAATAAATCCCTAATTGACTTCATTTAACTATGTCTAATTACAAACATGTATTGTAACTATCTGCG
CACCACTCATTGCATGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTCGATCCTATATCCACCAATAAGCAGTGTATTACATCTGCGAGGCAATAT
TATCTATTCGGATAATATTATGAGAATATTGTGTTTGTCCTAACATAATATTCATACTTGATAATTACCTTATGTAAATTATCATGTAACGGAGGCACCC
CGTTACATCACCCGTCCTCTTAACCATGAGTCACATTAGTGACTGATTGATGATTGAATGACTCTTTTTTTGAGTGGCTCTGGGACAGGGAAGCACTTTT
TGGCCAATCCATCCATTCTTCATTCTCATCGCATGGTTAACAAGTCCATGCGGTGTGCAGCCATGAGACTCCGCTCCGCTGCCGCAAGGGAGATAGGATC
ACCCAAAGCAGCTGACGTAATTTTGTCTGCTTCTTCCGTGACACAGCCTGCAGCAGTCGCTGCTGCAGGCGCACGCGGTGATGCACCGCGTGACATCGGA
TATTATGAGCTGGAGCTCATATACTCTGGAGGTCTGACGGTGAGACCGACTCGAAGGAGTCGAAAGCCAATGATGAGCCAGAGTTGGATAAACCGGAGCC
GACTGAGTCGGCTTCTCGAAGCGCTTTAAGCCTTGCAGATCGTCGTGACATCTTCGGATCGTCCGACGAGTCCGACCCTCGTCTCCGAGACGGAGTCGTT
CAGCTGAAAGCGAGAGAGGCCATGGCTTTGGCCACCGGAACGATCTTGACGGTGATGCAATCATGCATCAGAGTCCGGGTGATCGGGATGATCCTGGTGT
CGGTACTTCTATTGACACCAGACAAGAGACTGTGGATCGCAACATCTTGCGAGCTGCTCCTGAGAAGAAGCCGTGGCTACATCCTCAAAAAAGTGTTGAC
TCGTCTGTCTGACACGACGAGTGATCGTTATCGAATAAGATTGTTCGATTCATCAAAGCTTCATAAGCTTGATCCTAGTGCGAGTAACTGTCACACTGAA
CATGATTTCTTCATCGATGCGTTCTTTAAGCATCGATGGTACAGTGGGAATCACAAGTGTGATATTCCCTCATTGATTCAGGCATGGAACGCTTTCATCC
TCAACATTGGTGAGATTGGGTGTGATGCTTGGCTAGACAAGTCATTGCTAGCTCGAAAACGGTTTGAGAAACGGACCTCTACCGGTGCACGTTTCAAACT
GCATCGGTTGTCAAGAGAGACCGGGCTACCATGCCTCTCTTGGGGTGATGCGTGCCAAATTTGTGTGAATAACTTGGCACAAGCTCCAAAGGAAGCCTAC
TCGATGAATGACCCCTGGTGGAGGGTACGTGTCACTCAAGAGATGTACGAGGGAATAGCTAATTTGCAATCCCTCTACAAGCGCGCTGGGCGTTCGTTCC
CCGATCGGCGTCCTTCGGCATCGGATGCGCCTTGTCAGACTGCTCGACAAGGCCCAAAACATCAACCAGCAGTTGGGAGCGAGGCTCCCAACTATCTGCC
GAGGGTGGACACCCGCGCCACCGGACGAGGTAACTCTTCCGACGTCCTTCCTCATCGCGGTGGTTCAACAGGCGTTCCACGAGGAAGCGTTGGCCACCGC
GCGCATGCGGAGGAGGAACACATTCACAGAAGGGTTTGAAGGTTCAATCTGATACTGTAAGCCAGCTCGAGCGCGTAACGTGTGAGTTGCGCGAGGAGAT
CGAGCACGAGAGGAGCAGACGTTTGGGCTCGTCGACAATGTGACACGTCTCTCCTCGGAACGGGAGAGAGATCGATCAGATTTTGCGTTTTCTCAGCTTG
AGAACGAGCGGACTCAGTGTTCTCTTCGCGACGAGCTATTGGAAGCTCTTCAGGATATCGCTCGGCTTCACGGGGAGATATCCGAACTTCAGACTTGGGC
TGATAGTCAGCACCGCGAGCACAAGTATCTCTTGGAGATGCTTGAGCGCAAGTGATTTCTTCACCGGAAGAAGTCCCGTACTGGTGATAAGACTTAAGGC
GACCGACGTAGAACGTAGGATGCATGCGCAACTTACGTGGCATTTCAATCGTGTATGCGTTGCCTAAGCGGCGCAGCACACGAAATGGACCGATGAACTT
AGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTTGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTCACCTTCAGTGAATGGAAAAACATTT
GCCCTTCCATTTTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACGGACAACCGTTTTGCGAGCCAGTATGAATT
CATCTGCTGACTCGCTTTCTTTGACTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGTGACCTGGGTAGTTAGAGCATCCTCGCTCTTACTTTCCTC
TTCTTCACCGAAGTCGATGTGATCGATATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCACTCGAACGA
TTCTCCCCCCCCCCTCAAACTATAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTGACGAAGAACGGTGTATGCGTCGTCGATGCA
TGCACCGAGTTGTTGATGGCGAATTCCACAATTGGCAATAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCGAACGATTTCCTTAAGAACGCGGT
TTGCACACTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTACCGAGTGTTTCGAACGCGGATCGCCAGAATTCTGCAAT
GAACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGATAGATCGTGTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTGAT
TCGGGTACAGCAACCAGATGTATCATTTTACTGAATCTATCAACGTACACAAGAATACCTGTATTCTTGTGTGGGTGTGCGGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTGTCGGGTTACGCATCCGGTTCGAAATCAGGCAGAGCATCAGCGACGACATTCAGTCTTCCTGGCTTA
TATTCCACGGAGAAATTATACTCCGCGAAGAACGACAGCCACCTCGCCATTTGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGT
CCGTGTAAACGATGAAGGTTCTACCACCTAGCAGGTAGACTCTGAATTTCGGCAAAGCGTACTTCATGGCAAGGATTTCCTTGTCATGGAATGGGTAGTT
ACGTTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTT
GCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCAAATCTTGATACCTTCGAAGGAGCGCTGGCAAT
CAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGACCAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAG
GCCAAGGAAATTTCGAAGTCCTTTTATGTCGGTAGACACCGGCCAGTCAGTGATCACCTTGATCTTTTCCGGATCGAACCGGACGCCATGGTTACCCACG
ATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATGCACCACTTGAGGTTGGCGTACAACTTATGCTCAAGCATCAGTGTAAGAAACTTCCGGTCGT
GGAGTCGGTGAACTTCCAATTCCGTCTGTCCATCCATAGCCCGGCTATGAAAGAACACATCATCGAAATAGCTAGGTGCGAATTCTTGCACATATATCAA
CAGATTCGTAACACATCTATTGAACGTATCAGGGGCATTACTCAGCCCTTGTGGCATTACCAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCT
GTGTAAGGAATGTCCTTTTCACTCATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGA
CATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAAGCATGTACTATCCGCCATCCTCCTGTGACCTTTCGGACACA
GAAGGTCGGAGAGCTATGAGGGGAAGTAGATTCCCTCACATGACTCGCTGCCAACCGATCGGCGAAGAATTTGTCAATCGCTAGTACTTGTTCACGAAGC
AGTGGCCATTGCTTCATGACACAATAATTTGAACCTGGTTTCAGGCCGATCTCATGACGAGTACCCTTATCCTTAGGTAGCTTGCACGGCACTGTTCTGG
GAACACATCTCTGAATTACGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGATCAATCCGAGTCTTCTCATCG
AGGACACTCTCGTCCATTGAAGAACTGCTGAGAACCCTTTCGTTCTCAGCAAATACCATTGCCGACCGAATATCGATTACGTACTCGTCTTCCGCGACGA
GTACGCAAATCTGCTTGACTTTGCCACTGCGCAGATCATGCATGAACCTCTTCTGTTTGAGCGTTGGCAACTGAGTGATCTCCGAAGTTGTCTTCGGAGG
CGCGATCAGATCAAGTGTATGACTACCTATTCTTGATCCGTCATTGACCAGGACATTTGATGTCTCTGTTATCTCCTGGGAACTTATTTTCACAGTTGGG
TGGGGACTTATTCCCTCACTAGTCTCTTGGAATAAATCATCACATGACACGAGTGGAATTGCTCCCTCGCTATCTTCTGGCGGTGGTTGCGCTACCACGG
CCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCATTGGCAATCGGTTCGTTGTTACTTGGGTGTTAACCGTTTGAAGG
ACACCCATGCCCAAGAACACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGATTCTGGCTCCATGGTGTGGGGA
TTAGCCACGCCATGGCCATATGCAGTCGTATTAACGACCGAACCACACGCGAGGTCATCAGATGGCCATCTGATGAACAACTTACAGGCATATCGACTGT
TCGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATAACATCGAATTTGTCATCCAAGTCCAATATGATGAAGTCATCA
TCGTATTGGACTCCCTTTAGTGTATAGGTAATACCCACTACACGTTTCAATACTGTCACGGATGCGCCTGTTGCGAGGCGCACCGTCATCCTCGGTGGAG
GGATCTCGCGCTCGATATATAGCTCGTGATTATCTAGCGATTGGCGTCGTACGAAGTCGTTTGATGCTCCAAAATCGACTGGGGCTCGTAGTGGCATATT
TCGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGATTGAGTGTTGGGAGAAACTTTCGTCTAGAGGCCT
GCAAAATCACTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTCTTGGCTGTCCGTTTCGTTGTTGCGTCTTCGCAACAAC
TACGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTATTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCGTATGCATAATGC
CCTGTCTTCTGACATCTATTGCATTTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTCTCGCTCCCCGCGTGACAGAGGTCCATTGGTTCTGGGCCTT
CATTTTCCTGTGTTCTCGATGGACGATAAGAATTCAAATTCGCGTGAGCCTGTATCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCTAG
GGTGTTGAATTCCAACCGGAACTGGTAGGTTTTAACAGGACCATCTGTCAGACCCTGCATGAACAACGTAATCAACTTTTGTTGATTCAGTGGGTCGACT
GTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTATCTTGCTTAATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCAG
CTCGCGGCGGCTCAATAGTTTACCTAAGCAGAGACTTGAAGACTTCCAGCGACCAAAAGAAATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTT
TGCACGCCCTGCCAAGTTCGATTGAGTAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTGATGGCATCGTCTAGTTCCACGAATCATCTT
AACAGGGAGTCTTCATCGGCTCCCTTGTACTTTGTGATGTCGATCATTAGAGTCTCGGGTCGACGTATACACGTCGACCCGGTAGCAGTGGCCTGCTGCT
GTCTCAACAGTTCAAACTGTTGAGCACTATGTTCTCTAAACAGCTTTGTCTGTCGAGAACCTTGTTGGTGAAGCAAGGTTACTTTTTCCCTCTCGGCATC
AAGTTCGTTCTGAATGAACGTGGTGATTGTGGCGTGCTGGCCGTTGCCCCAGGGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTCTAACTCAA
GCGTTCGACGGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCGTGCGTGGGATGAAAATCACCCCCCTCATCGTCCAACATATTCATGGTCGTT
GAACGGACTACGAAGTGCTACCAAGTGTAACTGGGCACACCTTATTCAACTAACGGAATAAACCTTGCATTGCTGACAGTGCAAGGGTGTGTGCGTCCGA
CTACCTCACGTACACGTATGTGCAGAGGAAGATTGCTATACGGAGTAATAGTGTTCAGTGAAGGTAAAAAGTAGAACTCTATTTAGTATAGTTAATCCTT
TTAATAAATCCCTAATTGACTTCATTTAACTATGTCTAATTACAAACATGTATTGTAACTATCTGCGCACCACTCATTGCATGCTTCTGTCGTGGCTAGA
CTTTATTGGTTGATATCTCGATCCTATATCCACCAATGAGCAGTGTATTACATCTGCGAGGCAATATTATCTATTCGGATAATATTATGAGAATATTGTG
TTTGTCCTAACATAATATTCATACTTGATAATTACCTTATGTAAATTATCATGTAACGGAGGCACCCCGTTACAATATAAAAACACATGATTGACTAATT
TATAAGGCATGATTAGAGGGTACGATATCACTGTCACTTACTTATATGGGAATCATTCGATCGCCTCTACCTTCTTGTTCCGTCGCCTGCAGATTTACCC
AAATATACTACAAACCCGATTCATCGTTTTTAGCCATTTCTTACGCTCAAACCGAGACTGCGTGGTCTTTTTCTATCGTTTTTTACATTTCGTTTCCTTG
GTGCTTGCTATATTCTTGGCCGTGACTCAGCTATCGTTTTGCGGCGTGGAGGAGCAGGTTCGGGCGCGTTGTGTCCAGAGCAATGACACATGCGACAACT
CTAGACAACGACAATTGGCTCAACAGCCAGCTCCACATGCTCAAACTCTAAAAAAACATCGCTGCGTTGAACTAACGGATAATTAATTTTTCTATTCTGA
CCGTCGGCCACGTGCTTGGATTCTTTCGGGTTAATTTACCTTTGTCGCATTTCCCAAAAAAAGCTCAATAGTCTGTATAAAAGCAGATGTCTCTAATGAT
TTTATTTGATTGCCCCAGTTACTGAACGCGTTACCCAGCGGGATTTACTTCCAAGTGCTGGTAGGAAACGAGTCACTTCCGTCACCTAAGTAATTCGGAA
GTCGTAAAAACGACAGGGCTACGCATTTCTTACGCGGTTAACCCTATCGTCACGCGTTTTATCCATGGCTGTAGATTTAAGGAGTTATTAACAAAGCAAA
GAATATTCCATTAGACACATGCAATTAACTTCTGCTCACCTCAGTAACAAGAGAAATCTGGTCGAGAAGTTGTTGAAGTGGCGTCGATCCTCATCCTAGT
GGTTTTCCGCGTCTTCGTAGCTTACTCCTAACGAAGCGCAACAAATAGGCCATGTTAGCAACCTTGCACTTTACATCTCTCGTTGGCTATAATTGCGCAT
GTACTTCTTTTGTTATAACCTCGAAATTGAGTTCCACCCGTCTCCGTGACCACCTGCTCACGTGCCTTTTACAGCTTCTTCGTTCGGAATTCTACTTAAG
ATAGGGGAGCTAGCTCTAGAGCTCTCTCTTTGATATAAGTTATTTAGTCCATAGAACTAAATCAAGTTACAAAACACTATACAACAGCAGCAGTCACTGA
AAAAGGATTATGATGCTGTTAATGTCTAACTTAACCCAGTAGTGTACTCATGCAACGCGATCAGCCTTTGCTAATGAGCGTCTGGCCTTTGCAAATATGT
AAATATTCACCTATGATCGATTTTAAGCCAATCGCGTACGTGGGTCACAATAGTGACTTAATTTATAGAGTGACTTTAATATATATATATGACTATGAGG
AGGAGACAGGTTAAAAAGCACTTAGTACGTGTAAGGTACGCCTAGCCGCGTTATTGCGAGCCCGAAAGTTATTATTGACTGAGCGCAAGGCGAATGCCGA
ACTTTTTAAATCGTACTTATCTCTGTGTGTGTCTGTGTGTGCCTGTGTGACTGTCTGTTAATAACGCGGTTAAGTGTACCTTACACGTAGTAAGTGCGAT
CCAGCCTGTCTCCCTCGTAGGTATAGATATATCCAAAGTCACTCTTTGGCTTGGTTACTATTGTGGTGCACGCTTGTGATTGGCCTAAAATCGATCAAAG
GTGAATATGATCACATCAGCAAATGCTCGACGCTCATAAGCAAAGGCCGATCGCGTTGCATAAGTATACTGTACAAATTTGATACAGACATTTACAGCAT
CATACCCATTCTTCAGTGACTTTTTGTAACGGGGCACCGGTCGCTTGTACTATCACAGTATAAGCTGCTTACGCTGAACAAAGAGTAAGTAGGTGCCTCA
ATATCGCGCGTACACGGATCGTGTAGAGGAAGGTTTGAATACGAGATAAGGGTAAAAGTAGAACTGTATTTAGTATAGTATATCTCCTGTTAATAAATCC
TATATAGTCTTCTTTAACTATATCGAATACAAACATGTATTATAACTATCTGCTCACCACTCATTGCGCACTTCTGTCGTGGTACGGCTTCATTGGTTGA
TAGCATTAACCAATATCAACCAATGAGCAGTTTATTACTTCTGCATCACCAAAGTACTTGTTAAGATAGTATTGTGAGAATATGATGTCTGTCCTAACAA
AATATTCCTACTTGATATTTTCCTTATGTAAGGTATCATGTAACTGAGGCACCCCGATACGCTGCTGCTGTGTAGTTTTTTGCAACTTGGTTCAGTTCTA
TAACTGGATTACTCATATCAAAGGGCGAGCTCCAGATCTTGCTCCCCTATCTTTTACAGACAGACACACACACACACAGATAGACAGACACACACACACA
GATAAGTACGTTTAAAAAGTTCGGCATTCACCTTGCGCACAGTCACTATAGCTTCACCTTTCCGGCTCGCAACGATTGAAAAAGCTCGGCATTCACCTTG
TGCACACTCACGAACAGTTTCACCCTTCGGCTTGCAAAAATTAATTTCGGCAAATACATATATGTTTTGGGGAACAGCAAACGAGTGATATTCAGGGTAA
TTGTTGTATATTTGGGTAAAACTGCAGGCGAAGAACAAGAGGGTAGCAGCGATCAAGTGATTCCCTTCTTGTTGTGCAAAACAGTTCAGTGGTTTATGAT
TATGACAAAAATTGACGTTTAGAAACAGCTGATAGTGATATCGTTCCCTCTATACATGCCTCATAATTCACCACTTATGTATTGTAATATCAAACTGAGG
GAGCTTTATTAGAAAACTAAGTCAAGATCAACGCTTCCCTGCATTTTCTACATTCTAATCTGAATAGCACAGTCTAATCACATAATTTTCAATAAGTTTT
GGATGTTATTTCTCTTGCGCGGAATATATCTGAAATAAGGTGACC