Description :
Non Conding Region
Location :
Scaffold_1:56231- 57128
Sequence
897 bases(100 bases per row)
TTCGTCCACTTTTTCCGTGCGCAGTTGTTCCAAAGGTTGCACCGACACAGACTATCGGTGGTCTCCAGACGTCGGTGGCAACGCCAGTAGCGCGTCTCGT
TCTGCTGTGGACGTTGCTGCCGGTGGACAGCTGCGCCCGTTGTGCTTGCACAGGCGACTGCACCGCTGTCGAGAGGCCCCAGCCCCGGCTCTTTTGCGCC
ATAGCGGCCACGGGCCACTGCTGTTGTCCAGCAGCCATCGCCTGCGTGGAGGTTAGCGCTGCACGTTCCACAATGCGTCTGCCGAGTGCCTCGTCATTTG
CCGCGGTTCTCGCCGGACGACCAGCCCTGCATTGCGCTTGGCGTCGTTGTTCTCCTGGCCCTGCCGCTTGTCTGCTCGATGTGCTGCTACTTACGACTGC
TACGATCCCGCGGGCACGTTCGTCGACAAGCTGCGCGACCTTCGGCAAATGCGTACGAGCCACCAGACGTTGTGGGCCTGAAGACCCCGTGCATCGTAGA
GTCGGCACATCCAACGGCCGATGGCAGATGCAAACACGCTTGGCCGTTCTGACTCCTGGGCCGCTTGCCACAGCTTGTAGCTGAGTGGGCTCAAAGCGAC
GTTGCCGGCGCATGGCAGGGCGCCTTGGCGAAGCAATCGGCGAGCTGCCCGCGATGGTCGCCGCGCCGATTCAGGATGCTTGCCATCGAGCTCTGCCATC
GTGGCACCGGCGTCGAACGTGATCACATTCAGCTGCAATCTTGAAATTATAAACCAATTGAACGGTAGACATACAAATATCCAGTATCTTTTCGGCCGGT
TAATTATTTTGGATCGCGTAATTTTATTGACGTTAGAGTCGATAATTGTATGTCTATTTTTACTTTTCTAAAACTGCGTGCGTGGCATTCCGAATTT