Description :
Non Conding Region
Location :
Scaffold_1:56074- 56667
Sequence
593 bases(100 bases per row)
TGCGCGTGCCTTTCTTGTAGAACTTGAAGTTATGAGCTCGTGGGCGAATGCGCCAGTGCTCCCTTTGAAGCATGCTTTTGACTGGTTTTCAAGGAGCTGT
TCAAAAAGGTAGCCATTATCAGATTTTTCACACCTGGGCAACGTCCTCTGTCAACGTTGCGCGAACGTTGTCTGAATCTACACATGGTACGTGCCTGAAA
ACATATCCGGAAGGTATACTGACCAGCTCCGGTTTCTACAAGTTCAGAAATCGGTTTGAAGAGAAACTGGCAACTGATTTTTTAGCACAGTAGCTTGGAT
TATTATTTCTCAGAGGCAATATTCAACTTACAGGGGCAAAACGCAACACAAAGTCCATACATTTTAGTACACATTAATTGCGAATCCCTTCATTTGCGAC
GCACGCGCGGCATCTCGTCGTCTATTGGGGGAGCGCTTCTCGCAGCAGCAGCACAGTGCGCGTGTTGTTCTCTTTGTCAGCGAACAGCGTCATAGCAGCA
CCGGAGAGATGGGGTGGTCAAAATACGATGCGCCTGGGATCGCAATGTTTTTTTCTTGTTGTTGCTGTTGCTTCTTTTCTTTTGTGGGCTTAT