Description :
Non Conding Region
Location :
contig_1:55770- 57603
Sequence
1833 bases(100 bases per row)
ACTGACGTTGTTTCTCCTTCCGTGAACAGATCCTGCATGTGAGCAGGCCCTGCAGGAGAAAGAAGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTG
GCAAGCAGCTGTACGTGGAGTTAGTCTTGAAACGATGAGCTAGACACGGATGTTGATGCCTTGCTGCTCTACAGAGCCGATGACAAAATAAAAATACTAA
GTATATATAACAATTATACTAGTATAGGAATGTGCAACTACGTTTTGGATAGTGGATTAAAGTGTAAGGCAAAGCCATCGCAAGAGCGTTGTTGGTAAGC
ATCCATTTTCAAAGTTTCCTTCCATATGAAATTTTCTCGCCAGAGGTCAGTGAAGATATGATGAAAAGAATAATTTCAGCTCCGAGGATGAAAGAATCAC
TTGCTTGTGTGGATCATCGATGGAGAGATGGAATTTCGCAAGCCTGCAATAAAGAAAAACATTCGAAGTGGATTAAATCAATGCCATATCCGCAAGATCT
TGGGTGGTGGGGCCCAGACTATAGCAAATGGTAAGCAGCTATCCAAGTATTATATTTTTATTTTTGATAAATATAAAGTTAGTAATATAGTAAGATGGCG
TACTCTCCGAGCAATACGAACTTAATAAAGAGCGCATCAAGGCGCTACTATCTAAAGACAGGGAAACGCGACTGGCGAAGCAGCGAGAATATATGGAGCA
TCGACGGAAATTCGTGCTCGTAAGAAAAAAATATTCAAGCAAGTCGGAACTTAAGCAAATTAACGAAAGCGAACTAGCTTAATTAAAAAAAATCTCGGAT
ATAATGTAACGGTTACCTGAAGAGTGCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACATCACTGACACGTTGTGGTGGCTCACAGCCACCCAT
ACATAAAACATATAGGATAAACTATAGTTGAATTAGGAATGTATTGCAGACAATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGT
CTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAACACTTCTCAAGCGCAAGGTGCTGTGTGATTC
CCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATC
GCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATACCCTCCAGAGCTTGGCGGCAGCAAC
ACCTGCCGAGCGGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGTTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGG
AAACCAGTTCAGCCCAAGTCTTTGAGGCTGAAGGTTAACCTCTACGAAGGAAAAGAAGGGGGAAACCTTCACTTCTGGGTTCGAGAGGTCGAGCTCGCTA
TGGACACGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTAAGTGGTCGAGCAAAGTGCTGGGCGTAAGACAATCTCTAGGT
AACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATA
CTCCTAACACTTCCTCAAGCGCAAGGTGCTGTGTGATTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCT
GAATCCTCTGTGGTCTCAAGCATTGAGCCACCA