Description :
Non Conding Region
Location :
Scaffold_1:55734- 55841
Sequence
107 bases(100 bases per row)
CATGCCAAGTGTGTTTGGCTACGCACAGAATAATAAACAGCTCCACTGCTATATGCATCGATTCTTGGCTTCATTACCTCGTTCTGCTGCTACAGTTTAC
GGTCACC