Description :
Non Conding Region
Location :
scaffold_1:55713- 56005
Sequence
292 bases(100 bases per row)
GATGCTTCTTAGACAACGGGCCTCTTACGCTACTGCGTTGGCTCATACAGCAAATAGACAAAAGTGAGGCTGCTGACAATCGCTTCAACTTGATCTACCA
ATCAGCATCAATCGCTAAAAAACCTTGAATACCGAGGTTTTTCGCGCCATGATTTGAAAATGCAAATACCGGTATTTCACATATCAGCATCGGCGATGGA
GGAGGTCGCGATCGAGGAGGTGCACCAACCGGAGCAGGAGCATGAGCCACAGGAGCCCCAAGACCTGGAGTTGTGGTGCTTGATCGTGGGCA