Description :
Non Conding Region
Location :
Scaffold_1:55666- 55965
Sequence
299 bases(100 bases per row)
AGGGCGTTCTTGTTGGCAAGAAGAAGAAAAAGAAGGAAGCAAGGTGACCGAGGGAAGGACATGGGAACTTGGGCTATTTCTCGTCAAGAGAAAACGTTAA
GGCGCACTAATACAAAAATGGCTTGGATTTGGATTTCTCGACTGTAGTGTTTGTGGTGGTTCGTTGTGGTGATGCATACATTTGTGTGGTTAACTACGGA
CTTTGAAGCAAATCGTCTTCTTCTTCTATTAGGGTGCAAACAGAGCAATGGTGGTATGTGGTTCTTCTCATTAGCAAAGCAGTTGACAACGCCTACGCC