Description :
Non Conding Region
Location :
Scaffold_1:55528- 58533
Sequence
3005 bases(100 bases per row)
AGTCTGACCGAAGACTTGAGTTCTTGATGTACAAAGGGGGgAAaTATTCTCCGCCACAGCACATTCCGGTGAATTACTATCTCGACTTTCTCCGCAGTGT
GAGATACCTCCTTCAACTCCCCCACTTTCACGGGCCTCAACACAATGCCTCCTACCTTGTTCTTAACAGAGCCGAACCCGCCACATGTGCGAGACAGATT
CTCAACAGTAATTTGAGCAATAAGaCCGACGAACCCGGATCGATTTCTCCACTTGTTAATGGATTTCGAATACTTAGAATAACCTCCcACATAAACCGAG
TTTGGAGCACTTGTGAGTGAAGCCCACTGTGTGCCTGGACAGCTGCAACCAAGCGCACACTCGAACCGACATTGAAAGTTAGAGCTTGAAGAGTACGGTA
CCACTGGCGCGATGTCGACCAAATCGCCATCAATAAAAaTGCGAACATGATAGCCGTCGAAGCTAATAGTTAAATTGACCCAACGGCCCGTTGGAATGTC
ATAATCAGTTGCCCAGCACTCATAATCCTTCCACCATACCCTACATCCTGCGTTCACAGCACCTGTTTGGCACTGCTGAAGTCCACTGGGTAAACCACGG
TCGAAAATGACAAAaCGGAGATTGTCATGCGAGGGTACCCGCCCAATTTTACAAGCAAGTAGCTTTGGTGGATGAAGACCTTCTCATAAACACATCAATG
TCAGAAGTGATAACGATGACAGCGATCGGCGTCTGAACCTaCGGAAAAGATCCTGTACGCTGAGGTTCTGGGTTTCAATTTGTGTCGCAACGGGACAACC
AAATACACTCTTGTTCGTGCTTCCACAGCAGCTCCATCGGACAAACTCTCCCTCATCGTTCAACTCGGGGTATAAGTGGCGAGATACATCAGATTCCCTA
ACATACTTGCAGTAGTAAGAGCTTGATAGTGATCGGCATGCCAGCATCCTGTACTAGTATCGTACACTTCGCCCTTCTCCTTGACATCGTCCGCAGCCTT
GAACAATCTGAGGTGCATTGCGAACGGAACTTCCACAACGCCCCTAGTAGATGCTCCTCGAGACCCCACTTCAATGAAACCATCGCCGTAGAACGACATC
ACCACATCGGGgTCACGTGTCTCCCAGCCATTCTCGTTCATTTtCACCTTAGGAGATCCGGAGGACGAGCTACTCGCCTTGATCTTACTATCTTCGTCTC
GCTTCGGCTCGACTTTCGTGCATCTGCGCGTTAATTCGTGTAAGAAGCGTCTTCATTGGAGTCGAAGTAGGGATCTTACCGCACACGGCATGCATCTGGA
GCCACCACCGCTTTGTTATCAGTCTCTACTCGAACATCGGACCCCGCTAGCCCCTTCTTCTCTCCCTCTCTATCTCCATCTtCCTTTGCAGCTTCCTCAT
CAAGCGCCCGGCGTGCAAGGGGCTCCCTCACCGTTGGCCGCAGTGGTTCAACCAAGCGACGCCCCGCGTTTCCTGGTCGCTCCGACGGCTGCTGAGGCTT
CCTTGCACCGCTCTTCGCCCCcGTGGgTGGACCTCCGACCAACCCATACACACTGAGGAGCGTGAGCTCTCTTCCTGATCGTCTCGTCGTCATCTGCTCA
CTCTCGTGCCACGcGTTTCCCCTGCGATGGCATCTTCCTGAATGGAGGTTTCCTGCCACTTCAACCAGCCGTGAGAGCGCTCTATTTtGGTTGTGCTTAC
AATTGCAaTTtGTgTGGATAGACCGCCTATTtGTTtGaGAATGAACATGAGCTGCTCATGCACGATGGTGGgTCTtGAGAGCCCCGACAaTGAGCTGTAG
CCACTTGACGGAGCACTTGGCCGCCGTCACGATCTCTTGCTTCACAGACTCTAGGTCAGCAATGAGCTGCTGGAGgCCGATCACCCGTGCGAGCGCCAGC
CAGTCCCCCAGCGGGAGTGTGCACACGCCCGCTTGTACGTAGCATGCTGGGTGCGAGTTGAAAGCGATAGTCTTAaTTtCTGGGCACGTTGGTGCCGTAC
cGTTCGTCGTGATAACAGGCACAAGCTCTGTCTGTAGGCAGTACATCACATCCGAGATCCACTGCTTGCCCTTGGCTGAGAACGTTGATGCGTTGCCGCT
GAAAGCTTGGCAGTACTTGCCACCGTAGCCCAGCGCATAGCCGCTTGGTCCACACGGGAACGTCGCTTCAAGACAGTTGCTGTAGAACGCACACGAGTCA
CGCGGGATCGaCGTCGTACAAGTCGGCGGTAGCGTCGCATGGGCAGCGGTTGCAAGCATAACACAGAGCACCACGAGGCTCGTGAGGAAGCTCTTCATCT
TTCTCGGTAGTTGGTTGGCGGCGGTTGTGTTCTTGAAGGCAAATTGGCAAATGACCACTCGCTTCTGGTTCAGACGAGTTGGCCAAAGGGAACAGGACAG
CGGCCATGATCAGGCGTTGCGAATTCGCTGCGACGGCTCCTCCATGCACGCGCCACCACAGTGGACCAGTCCACTGCCCGcTTCCTTCCCGATCGAAGCC
CATCTGACCTCTGGCAGCTCACATGACGAGCGGGAAAGTACAGCATCCGAATaTCATCCAATCAGACGTCTTGGGTACATGGTTACGCAGATGGGTAACA
CCCATtGGgTGTAACCCATTCATCCcACCATGGCACGAGAcGAAGATGGCACaGCGCATCGaCgCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAATGAGATTGGCGACTATATCGA
GAaGA