Description :
Non Conding Region
Location :
scaffold_1:55467- 55530
Sequence
63 bases(100 bases per row)
GTAGCAATTTATCGACACGGTTATAGAAGATGGATATGACGGAGTCATCTGTCTATGATGTTC