Description :
Non Conding Region
Location :
Scaffold_1:55419- 55486
Sequence
67 bases(100 bases per row)
GAAGATGCTTTTGCAGGAGATAAATGCTTACAAATGCACGAAGCAAAGAGGCAACACTATTCCACCT