Description :
Non Conding Region
Location :
Scaffold_1:55394- 55438
Sequence
44 bases(100 bases per row)
GAGTCCAACCCAATATATATATATATATATATATATATATTGGG