Description :
Non Conding Region
Location :
Scaffold_1:55218- 55460
Sequence
242 bases(100 bases per row)
CCACCAGAGTACGAAAGCAACTTACGCGCGTCTTGGGACCAAGCATGCGCGTTCCATCTACAGTGTACCACCACAGCAGGTACCGGTACTCACCCAAACA
CACAGTGTGCGGTGAGTCCGCCCCACAGCGTCGCAGACAGGCTCGAACTTGGAGATCCCGCCATCCAGCGTGGGACGCTCGAGAGTCTTGGCAGGTGCAC
GTGATGCGTGGCGCACTAGGGTTCTCATATTGCATCCGGATG