Description :
Non Conding Region
Location :
Scaffold_1:55013- 55169
Sequence
156 bases(100 bases per row)
cacttccagaatgaatcgatcaatcgtaattacgaataggaaattatattttgttttattttaaacaataataatgtttcacaatataattggcgggatc
acaaattttgtgatcccgccaaaattagtgtcattcaagctttctaccaccaaaca