Description :
Non Conding Region
Location :
Scaffold_1:54911- 55285
Sequence
374 bases(100 bases per row)
GTGGTGGCTCGTATGCGAAAATCAAGCACAATGTTTGCTGTCTGCATGCGGAGAGCGCGACGGTTATTTCATCAACAAAAAAGCATAATCTATTCTCGAG
TAGATGCGTCACATTGCGGCGCGTATTAATACCAACTGCGGGTGCTCGACTTGACTCACTGATACTAGTGCAAAGCTCAGTTGTTGCTCTCACGTAATGT
CAGGAAGACCTAACGCTTCGCGATCAAGGCCTCCAATGAGTAAAGATCTTTTGTTGCAATGGCACAAGAGTGTGAGGCTCTAGAGTAGTTTGTGTATCTA
AGCTCGTGTGTTTGAGATGCTTGAAAAGTTTGAGTAGATTACGAACTCAAGAGAGATACTAGCTTTTTCTATGT