Description :
Non Conding Region
Location :
contig_1:5467- 6825
Sequence
1358 bases(100 bases per row)
TTCAAGTCTGTGGGCAGTACCACCTTCGCGGGCTGCGTCGCCGCTGAGTCACGTGAAACTATACTCAACCCAGGGCAAGCAGCGAAAGCTGTGAATCTCA
TATTTGCAGGAATCAGTGCGCACGATGTCCGCCAGCAAGCCGGCCGTACTTATGGCAATGCTGGTGAGGTGTTACCGTCGGGTGTCTCAAAGATACTTGA
AGCTGTTGGACCCCTCGGAGAAGCCGACGTTTTCCTCGACGTTGGAGCTGGTGTGGGCAACATTGTCGCTCAAGTTGCACTTGCGACGAGCGTTAGAACG
TGCATTGGCGTCGAGCTTCGAAAGGATCTAGTTGCACTTGAGGTGAAGCGACTTGTCAGTTGGAGAGATTGAGCGATTCGGAAGGGACTGATGGCATGAG
ATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGATGTGTCCAGTTATGGCCAGTTGTGTACAGTGGTGTCCAGTTATGTCCGGTTGTGTTCAGAAGA
CATCCACCTCCGGATTGAAGTGGATACATGTCAACCTGATGAGTATGGCGTAATCATTTATGCCGACCTGATCAAGATCGATATTGAGCAATCATTTCGA
TACGTAATCTGATCCAGATCGACATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTGGGTACAATGGACCAATCTTTTCGACACGGTA
CCGCGATCTTGGTACATCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGAAAGCAGGATAGGGAGAGATCTTTAGG
ACCTTTACTTTTGGTTAAGAGATTCAGATTTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAAGGAATTACATTGGCCTACCCGACGAAGGA
CCCACCCAGTCGACCAAGGACACGACGCAGACCTGGATAGCTTGGCCAGGGTGCGATCGTCTACTCTCATCTCAACTCAAGACCCCGCCAGAGGAGGCGG
CAAGCAACGGAAAGGGCTACAACAGCACACCCCCAAGGACACCCCCCACGTGATCGACTTGTCCCAAGACCCGATCACCAACCACCGACGACCGCGTGAA
GGATACCCGCGTGGCCGTCACCCACCCATTCCCCGGAAGGAGCAGTCCAGCTCCAACCTCCGCCTTGGTCACCCACTGACATCTTCAGTGAACACCGGAA
GAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGACTACAAGGTTTTCTGATCACGCCTGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCTGGG
CCTACCGCTGGCAAGCTCGGATCGCGTCATCGATTTTCGCGATCCCGCTCCGCCACAA