Description :
Non Conding Region
Location :
Scaffold_1:54652- 56812
Sequence
2160 bases(100 bases per row)
TGTATTCCATATCAGTCAGGTTGCCTGGCGAGGACCCCACCGCCGTATGTAGGCGAGATCACTAATAGCAAGAGGAAGTCGCCGCAACCAAAAGGGAGAA
GAAAAGCAATAGAAAAAAGTCAAAAATGGGATTGTATGTGTTGGCGCATTCAGGCTTCTGTTCATGCAATGAAAGTTGGAGTTTACTGAGGTCCAAGTAA
GCATCTAGACGTACACTACAGTTGGTTTCTCGGTTTGATGAAAGGAATAGGCAAACGACGCTAAAAAATGTCTAGGAAGTCAACCATGCAAGCTCTGTAA
GTCCTGTATATGGAATACCTAACGACGCTTGATTGCAGCTTCCTCCTGCAGCAAACGAAAACCTCGAAGATACTGCTGGCATTGCGCGGCCGTGTCCGCT
TGAAGGTCCAAGGTTCGGCAAGGGTGAACGAACACGAGCGAGAAGCAGCGCGCAGGTGCATCAGGGCGCTGGCGAGCGAAGGTTTCCGTGGTCGCGCCTG
GCAGCACCTCCACCAGATCGCACGTGTCAACTTTCGCGTCGGCCTTCGGTTGCATCAATGAACCATGTGCAACCGAGGTAGCAGGCGAACGCCACGACAG
CCAGTGGCACTGAGCGTCTGAATACACAACACGTTGGTGAGGCACGCCACGCGCTCCGAACTTGGTCACCACAATGCCGTTTTCAAGCTGCTTCTTGAAT
TGCGCAAGAAACTCTTGGTCCTTGGCTTGAGCTGTGGCACGTGCTCGACTAGCACTCTCCAATTCGTCCACTGCCACCTGCAGTCGGATTTTTTCCGCTC
GTTCGTCCTCGCAACGCTGCTCGAGCTCGCGGATCTGGCGCTTTAGATCACTTTGCATGGCTTGGGCTTCCTCCCCCACTTTTTTTCGGACAACTTCGAG
CTCAGCGCTAAACTCACCGCGCATGTTGCGCTCACGGTTCTGGGCCTCGCGAAGCTCCTCATGCAGCGATGCCAACAACTGCTTGCTTGTGGTATTCACC
AGCTCCAGCGCGCGGACTTGTTCCTGCAGTTGCTTTAGTTGCTGATCATGACACGAGAATTCCGCCAACAACTCCTCTCGATGCTCGTTCAGATCCAGGG
TTCCGTCCTTCAGACGCTCCAGTAATGGAAGGGATGTAGCTGACGCCTTCGTCTCAGGTTGTGACGGTGGCGTGGGCTTCTGCTGACTGAGTGCAGCGGA
CGGAGGGGAATCTGGGCTGGGGCGAATTCCCTCGGTAGGCGGAGCTACCTCAGCGCGCGAGTTGGCGATCTCTAGCGCAGCTTGGAGCTCGCGCATCTGT
TGGGTCTTCGCGGCATGTGCTGTTCGAAGTGCAGCGAGCACAACCTCAACAGCGCGATGTGCTCGCTGAGCGTCAACAAGTCGGTCGTGCAATTCATCCA
CTTGCTTCTGTGTGTCTTGGTGTTCCTCTTGCATCTCTTGCCACTGCAGCGCCAGCATCTCTTTCTCGTGTCGGATCTGACTCACTTGTTCCCGACTCTC
TTCGGCGGCCGCAGTCTGCTCTGCAAGTTCAGCCTGCAAGTCTCGCAGAGTCTGCTCGAGCTCTTCTTGGTGACGTTGCAGCTGCACTTGCTCGGTCTTC
ACAGCTTCCAATTCAGCCTGCGTTGCAGCCGACGCTCGCTTGTGCCTAAGTAGCAGCTTGTTTACTGCAACCATGTCGTCACGCTCTCGCTGCACTTTGC
GGATTTCTTGCAGTAAGGTTTCAAGCTGGCGCGCTGCGACGTCCTGCTCTTGCTTCACAGCCTCCTCACGCTCTTGCTGCAGAGCAGAGAGTTGCTCTCT
GACTGAGCTGAGCTGCTGGCTCACTTCAAGATACTCGGTCTTGAGGTTGTTCACCAACTCGTCCGAACCTTCCGCTTCAGCGTAGGTTGTATCGGGGAGC
TGCACACAGTCACTTTTAATCTCCAGGCTGGCGCGGCTATTGCGTCGCGAGTTGGGCTTCCCCGGCCCCATCGACAGACTGCTTCTGCGTCGAGGTTGCT
TCGACGGAGCAAGGCTACCCAAGCTTTTTGATCGCTCTTCGAGGCCAGTGCTCACTATTCCAGAGCTGATGTCTGCCAGGGTCAAGGTCAACGCTGGCTT
TGCATCGCGCATCCTAGCAACAGCAATAACAGCATTAGAATATGACTGTAGCAGAATACT