Description :
Non Conding Region
Location :
Scaffold_1:54580- 55570
Sequence
990 bases(100 bases per row)
tcggCGATTTTCTATGGTTGGCAAAGAACTTCAATAAGGCTTCTGAATGTATCGTACTATCCGGGGTATTAATTTATACCAGTACCGGAAGAGGGAGCGG
GAACTGTATTGACTTGCTGTGCTGGTTCAGGCTCAACAATGCTCGTGCATTGTCATCTAGTATATGGGTTTTCCACCTATGAGGACGGAACTAAAGAATG
TCAACGCTTTCTTCAGCGGATACTTTCTCGGCTCATGATTTCGGTACAGCGTCGGTCAGTGTGGCGTGGAttcggcgctggtggctcAAGTGTTGCGGCC
GCTGATAGCCACAACTtgtgacggtggtggtgatatCCTAAATGGCAAGTCGAGTTGCAGATCCGAGGTGCAACTCGCTGTCGAGGTATGGTGCTGCCAT
GGTATATGCCTCCTCAAGCAGCCGACGATGAGCGTAACGGGCTTGCTGTTTGTAAGAGTACACACACACTCCCATGCCGCGATCCAGCGAACAATGGGTC
CGTGGAGGCACCCAGGTACTCAGTATATCCCCATGAACCTGGCTTCAGTTACCGAAGTATTTAGCGACGGCGGCTCCGCTCAGCTTTCCCGGCATGTCCA
CCCCCATCCTGGTCGCCTTATCGTGGGTCCCGAACTCTTTCCCCACCAGCTGTATCGCTTTGAGTAAAAGAgtttgggggggggggcggCTCCTATAGTC
AAGTCGAGTCGATTTTGCACAGGAGTCAGTTTTCGACTTACAACGGCCCAGTACCAGCGTCGGGTCGTGCGGAGAAGCAGTGCGGAAaatctccttcgtc
gcgtGTTGGTTGGGCGTCCGTTCGGGTGCAGCATTGCCAAAGAAGCCAGCGACGCTATCGCAGACTCGATCGAGCTCTAATACTACGGGAGGCGTCAGGT
GTCGAgacttcctcttcgtcttaTCCGTCCGTCagtcccagcagcagcagactcttcgacacagcagcagacactAACAGGCAGGTGCCA