Description :
Non Conding Region
Location :
scaffold_1:54447- 54616
Sequence
169 bases(100 bases per row)
TACGAAGTTCTCTGAAGAGACTTGTGAAGACTTACATTAATTTGTTTATATCGCGACAGCCGGGAGAAGTATCGCGCCGCACTCGAAGCTTTCTTCTTGA
AGTGCAAGGACGATCTATCATCAGACAGCATCAATCGGTTTGTTTGCTACTACGTATCAAATTCGATCA